Freshman Biology

Stem Cells and Protein Sensitivity

2012-01-29T03:51:00.001-08:00

Loading...

Goal: Students will describe how stem cells differentiate.
Notes: Gametes combine in fertilization, Mitosis, Differentiation.
Vocabulary: Differentiation, Stem Cell, Totipotent Stem Cell, Pleuripotent stem cell.
Stem Cell/Embryology videos from Teachers Domain.

Wednesday
Goal: Students will describe process of differentiation.
-Review Notes of fertilization, mitosis, differentiation.
-Stem Cell Powerpoint Pyramid
-Stem Cell Guy Paperwork and Complete with computers.

Thursday:
Goal: Students will compare stem cell differentiation with a sports team.
1.) Students work in pairs on Stem Cell Basketball Worksheet.
2.) Students complete white board showing another similar differentiation situation.
Goal: Switched to Thursday: Students will describe debate over stem cell usage in research.

Friday
-Start with frozen embryo in family scenario.
FRONTLINE STEM CELL Video start.

Monday
Goal: Students will describe debate over stem cell usage in research.
Finish Frontline Video on Stem Cells.

Tuesday
Goal: Students connect cell parts and functions to some other operation (anything but school)

Wednesday: Standards Reading and Completion of Self Evaluation.

Thursday:
Protein Sensitivity with Gas Pressure monitors. (Control Potatos, Acid Potatos)

Friday:
Protect your proteins ad

Monday:
Present protect your proteins ad.

Tuesday: Worm dissection: Homology Body Parts to human body parts.

: Field trip expectations of what to do, endosymbiosis presentations.
2/4: Field Trip Exhibits online exploration and worksheet of exhibits.

Finishing Genetics Going into Stem Cells

2012-01-25T17:56:00.000-08:00

Goal: Complete Meiosis with own genes and chromosomes
-Purpose of sexual production (Sexual Reproduction with Aliens Gizmo)
-Make a copy of your own genes.
-Complete meiosis with your own genes.
-Investigate next generation in combination of your genes with others.

Goal: Students learn how pedigrees show traits are based from generation to generation.
-Nicotine Addiction PI

Goal:
-Isolate DNA from Peas and mouth cells.
Vocab: Complete Dominance, Codominance, Incomplete Dominance, Polygenic Inheritance, Sex-Linked Traits.
Modeling activities related to each of these.

Goal: Students show working knowledge of pedigrees, punnett squares, and different inheritance patterns.
Activity 6 Worksheets in pairs.

Goal: Review means by which organisms gain variability.
-Notes:
Variation comes from...(Student whiteboarding their ideas first)
-Genetics Mutation, Crossing Over, Independent Assortment, Sexual Reproduction.

Test

Goal: Students will describe how stem cells differentiate.
Notes: Gametes combine in fertilization, Mitosis, Differentiation.
Vocabulary: Differentiation, Stem Cell, Totipotent Stem Cell, Pleuripotent stem cell.
Stem Cell/Embryology videos from Teachers Domain.

Goal: Students will compare stem cell differentiation with a sports team.
1.) Students work in pairs on Stem Cell Basketball Worksheet.
2.) Students complete white board showing another similar differentiation situation.

Goal: Students will describe process of differentiation.
-Review Notes of fertilization, mitosis, differentiation.
-Stem Cell Powerpoint Pyramid
-Stem Cell Guy Paperwork and Complete with computers.

Goal: Switched to Thursday: Students will describe debate over stem cell usage in research.
-Start with frozen embryo in family scenario.
FRONTLINE STEM CELL Video start.

Goal: Students will describe debate over stem cell usage in research.
Finish Frontline Video on Stem Cells.

Next: Standards Reading and Completion of Self Evaluation.

Protein Sensitivity with Gas Pressure monitors. (Control Potatos, Acid Potatos,

: Field trip expectations of what to do, endosymbiosis presentations.
2/4: Field Trip Exhibits online exploration and worksheet of exhibits.

Finishing Meiosis going into Stem Cells

2012-01-18T06:36:00.001-08:00

Thursday:
SWBAT: Describe Independent Assortment with coins and charts
1.)Paper Model Mitosis vs. Meiosis
2.) Mitosis vs. Meiosis on Teacher's Domain.
3.) Independent Assortment with coins.

Friday
GOAL: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.

Monday:
SWBAT: Apply genetics information to a cystic fibrosis scenario.
1.) Punnett Square Review
2.) Cystic Fibrosis scenario.

Tuesday:
-Meiosis with your own chromosomes and combination of gametes.
-Mitosis vs. Meiosis Around the room.

Wednesday:
SWBAT: demonstrate meiosis with paper chromosomes.
-Explore Next Generation

Thursday:
SWBAT: Complete a genetics and meiosis study guide.

Friday:
-Go over genetics study guides.
-Nicotine Addiction Pedigree.

Monday:
Test

Semester 2 Start

2011-12-18T08:04:00.000-08:00

Thursday:
Go over Final Exam item by item, Meiosis Acting Out.

Friday: Goal: Connect experimental results to genetic explanations.
Mendel Experiments Story Telling about mating.
1.) Mouse Gizmo Experiments
-Describe Parents, hypothesis, results, and conclusion.
2.) Genetics Exploration with Mice and Test experiments. Go through...
a.) Pure white x Pure Black
b.) Pure white x pure white
c.) pure black x pure black
d.) cross breed black x cross breed black
3.) Whiteboard predictions of white and heterozygous black mouse.
4.) Start Vocabulary descriptions.

Monday: Goal: Use appropriate terminology to describe genetic inheritance.
Variations importance with Darwin's Challenge

1.) Review: 46 chromosomes in each of our cells, 23 from mom, 23 from dad. Show gametes coming together.
Homologous Chromosomes in Somatic Cells, genes on chromosomes.
2.) Vocabulary: Genotype, Phenotype, Allele, Gene, Gene Activation, Gene Suppression, Dominant, Recessive, Heterozygous, hybrid, carrier, Homozygous, pure breed, F1, F2, Youtube Genetics Playlist.
3.) Utah "Observable Traits" Slideshow applying traits information. Create a Table of trait, phenotypes, me, mom, dad, brothers, sisters.
-9 Traits.
Observable Traits Chart for this activity. http://www.sonic.net/~nbs/projects/bio115l/form.html
a

Tuesday
Mendel's Basic Experiments
Meiosis with paper chromosomes and Punnet Square problems with the one mouse traits.
Meiosis Notes

Monday: Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review, with pieces of paper.
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.

Tuesday:
Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.
5.) Sex chromosome punnett square.

Wednesday: GOAL: describe differences between mitosis and meiosis.
1.) Punnett Square Practice Problem.
2.) Mitosis vs. Meiosis around room.
3.) Youtube Genetics Playlist on jgensic's channel.
4.) Lecture: Sex determination.
5.) Sex chromosome problems. XXX, XO, XYY, XXY

Thursday:GOAL: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.

Friday: GOAL: Students describe Egg donation process and ethics.
1.) Article and Scenario.

Monday:
-Meiosis "Independent Assortment" with pennies

Tuesday:
-Meiosis with your own chromosomes and combination of gametes.
-Mitosis vs. Meiosis Around the room.

Wednesday:
Thursday: demonstrate meiosis with paper chromosomes.
-Explore Next Generation

Thursday
GOAL: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.

Friday:
-Go over genetics study guides.
-Nicotine Addiction Pedigree.

Tuesady:
Notes on Mendel:
Start with experiment: TT crossed with tt, then cross Tt with Tt.
Austrian Monk, July 20, 1822 – January 6, 1884
1865 and 1866 which was "re-discovered" in 1900
29,000 pea plants tested.
Law of Segregation and Law of Independent Assortment as vocabulary.
Work into dihybrid crosses until bell.

Wednesday:
Vocabulary Review, Another Dihybrid Cross, Nicotine Addiction Pedigree Investigator.

Thursday:
Test Concepts: Genetics, Meiosis vs. Mitosis, Gametes vs. Somatic, Mendel.

Friday: Test.

Monday:
Tuesday: Cystic Fibrosis situation and article.

Extra: Mendel: Mendel meets Watson and Crick skits.
-Mendel Notes: You tube videos.
-Law of Segregation and Independent assortments.
Xtranormal: Mendel meets Darwin.
Key points:
-They never actually met.
-Darwin: came up with Natural Selection
-Mendel: came up with rules of inheritance
-Darwin's natural selection said that favorable traits were passed on.
-Mendel discovered how these traits are passed on.
-Mendel monk, Darwin English Naturalist.
-Mendel kept very detailed records

Goal: Describe Mendel's experiments, describe the process of meiosis.
1.) Mendels's Experiments interactive http://www2.edc.org/weblabs/Mendel/mendel.html
2.) Doing Punnett Squares around the room.

Monday:
Going into stem cells, embryo development, after meiosis in terms of organismal.

DNA to Proteins 2011, HPV, Vaccines

2011-11-14T17:10:00.000-08:00

Monday:
1.) Finish Phases of Mitosis Video.
2.) Making DNA Models with instructions from Utah Edible DNA.
3.) Start DNA to Protein notes with DNA as immobile boss and Protein as workers.

Tuesday:
Tay Sachs Disease:
Symptoms: relentless deterioration of mental and physical abilities occurs. The child becomes blind, deaf, and unable to swallow. Muscles begin to atrophy and paralysis sets in. Death usually occurs before the age of 4. What do you think causes this? Most common among Jewish people.

Goal: Students describe how DNA provides template for proteins.
1.) DNA controls a cell, how?
-It uses the force to control actions.
-It provides a code that determines the structure of lipids that control reactions throughout the cell.
-It provides a code that determines the structure of proteins that control reactions throughout the cell.
-It provides a code that determines the structure of carbohydrates the control reactions throughout the cell.
FACTS:
DNA too large to get out of the nucleus. But still controls the cell. How?

2.) Transcription and Translation Videos HHMI.

3.) Translation and Transcription Notes.
Step 1: Cell gets a signal that a certain protein needs to be made.
Step 2: DNA is unwound and transcribed into a mRNA molecule. (gene activation)
Step 3: mRNA carries DNA's message to the ribosome.
Step 4: mRNA is translated at the ribosome into a protein by tRNA bringing amino acids to the ribosome.
Vocab: Transcription, Translation, mRNA, tRNA, Central Dogma,

ATTACGATCTGCACAAGATCCT take it to protein.

4.) Translation and Transcription role play with DNA (ATTACGATCTGCACAAGATCCT) codes in groups. Sheet for DNA Helicase, RNA Polymerase, and then ribosome, and tRNA (one carrying methionine/aug, leucine/gac, aspartic acid/gug, valine/uuc, phenylalanine/uuc, and stop/uag.

Wednesday:
Review: Transcription and Translation.
1.) Prior Knowledge Question:
Is all of the DNA in a cell active in coding for protein?
a.) No, only certain parts of the DNA are active, this determines the type of cell.
b.) No, only certain parts of the DNA are active, this is determined by the individual.
c.) Yes, all the DNA is active, this is what makes cells different from one another.
d.) Yes, all the DNA is active, this is what makes individuals different from one another.
2.) Transcription and Translation role play review.
3.) Transcription and Translation worksheet.

Monday:
Review: Transcription and Translation computer interactives.
Have competition for
1.) Follow this series of links to work out steps to transcription and translation.
2.) Utah Genetics
3.) Teacher's Domain
4.) Explorelearning.com: Protein Synthesis Use a login and password.
5.) Another Transcription Animation
6.) Another translation animation.

Tuesday:
Quiz: Transcription and Translation.
1.) Show the pictures of glowing animals (How? Why?)
2.) Show to the class the paper models for transcription and translation.
3.) Students get a chunk of potato and a little peroxide and make observations and questions about what is going on. What could we do to the potatos to see if they still make bubbles tomorrow?

1.) Introduce enzymes as reactors in a cell.
2.) Hydrogen Peroxide breakdown with potatos, what is happening?
3.) Show a chemical reaction with catalase over the arrow.
4.) What could we do to a potato to see if it still breaks down peroxide? Make a plan and go with this plan to test tomorrow.

Wednesday:
1.) Molecular Workbench DNA to Protein
2.) Boiled Potatoes, Room Temperature Potatos, vs. Acid Treated Potatos reacting with hydrogen peroxide. Determine the maximum pressure after five minutes for each treatment. In notebook:
3.) Whiteboard the results.

Thursday
1.) Raw vs. Baked vs. Vinegar Potatos
2.) Single Gene Mutation Research.
3.) Mutation Type Notes Molecular Workbench.

Friday
Single Gene Mutation Research, find two sources for all information.

Monday
Review
1.) DNA to Protein one sequence using promethean board.
2.) Finish Single Gene Mutation Research.

Tuesday
Tree Man Video, Tree Man Whiteboarding, Warts Picture: What do you think is causing his hands, legs, and skin to change like this? Pictures of warts.

Connect DNA mutations with the cell cycle. Nobel Prize.

HPV: Steps to cause cervical cancer/warts.
HPV Vocabulary:

1.) HPV gets into a cut
2.) HPV inserts its DNA into your DNA.
3.) Bad proteins get made, the cell cycle goes out of control
4.) Extra cells are produced.

Tree Man, Vaccine, Antibodies, Immune System.
Gardasil steps to make it work.
1.) Shot contains protein portion of HPV, not the DNA.
2.) Your body makes antibodies to fight the proteins off.
3.) You keep those antibodies in your system.
4.) The antibodies fight off any real HPV that may enter the system.

Wednesday
1.) Listen to Chicken Pox Party Audio from Big Picture Science.
2.) Review how HPV and Gardasil works.
3.) Half-sheet and whiteboarding what you remember.
4.) Gardasil Pros and Cons Research. (Create a table of facts)
5.) Should State make it mandatory? Research.

Thursday:
1.) Review how HPV and Gardasil Works.
2.) Whiteboarding group conclusions about Gardasil (should state make it mandatory)
3.) Come to conclusions as a whiteboarding group.

Friday:
1.) Whiteboarding Poker Review: DNA to mRNA to Protein, HPV to Cancer, Vaccines

Monday:
Gene Activation Activity, Poker Review

Tuesday:
Test, DNA to mRNA to Protein.

Wednesday: Final Exam Vocabulary Review, Endosymbiosis start-> Skit start.

Thursday: Vocabulary Review for final on a poster to show how ideas are connected.

Friday: Rudolf Graphing,

Monday: Acid River Review

Tuesday: Final Exams

Go Go Stem Cell Activity:
Stem Cell Niches
Steps that occur
Purpose for the stem cell waking up.
Gardasil vaccine steps, reading.

DNA Structure to Cell Cycle

2011-10-24T17:15:00.001-07:00

Monday
Goal: Describe Structure and Function of DNA.
Hook: With three sequences make a chart of relatedness.
Engage: Putting DNA models together,
Worksheet time: Finish Amino acid and DNA connection chart.
1.) Formative Assessment
When you examine the DNA inside a skin cell on your finger and examine the DNA in a muscle cell in your heart, what will you find?
a.) They have different DNA because they look different.
b.) They have different DNA because they do different jobs, one protects and one pumps.
c.) They have the same DNA because they are from the same individual.
d.) They have the same DNA because they are both from a human.
Socratic Discussion.
2.) Notes on Basic Development: Fertilization, Cell Division, Differentiation.
3.) Building DNA molecule models: Two strands that are complementary. Using old models. (14 sets) TACGATCTGATC (Totals of 14 T's, 14 A's, 10 C's, 10 G's) 48 total.

Tuesday
Goal: Describe the process of replication.
1.) Describe and model the process of replication of DNA.
Steps to the race:
a.) DNA helicase separates the DNA strands
b.) DNA Polymerase brings in spare nucleotides to create two strands.
c.) Practice in your pairs to go as quickly as possible.
d.) Go against one another

Wednesday
Goal: Describe the process of replication.
1.) Replication Tournament
2.) Nobel Prize DNA game.
3.) Explorelearning Replication interactive.

Thursday
Engage, Teacher's Domain DNA Replication. DNA Replication Tournament.
Goal: Describe the cell cycle.
1.) Notes: Cell Cycle: Growth 1, Synthesis, Growth 2, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis.
2.) Cell Cycle Act out with the paper chromosomes (I describe the stages)

Friday
Goal: Describe the cell cycle.
a.) Finish Cell Cycle Notes
b.) Give pieces of paper of different descriptions of the cell cycle stages.
1.) Cell Cycle Practice with chromosomes.
2.) Cell Cycle Ordering on paper.
3.) DNA Replication as a class with Poster Board Cut outs for speed.
4.) Add mitosis, interphase, more details to cell cycle notes
5.) Cell Cycle Timing Activity

Monday
Goal: act out cell cycle.
Why does DNA need to be copied? Scrap paper start.
DNA replication act out with sheets of paper.
Cell Cycle Vocabulary.
1.) Cell cycle ordering with pieces of paper.
2.) Cell cycle roll play?
3.) Cell Cycle reading 8.2 and 8.3 notetaking and reflection on the back.
4.) Problems with the cell cycle?

Tuesday
1.) Cell Cycle Role Play with pieces of paper.
2.) DNA Replication, Structure and Quiz.
3.) Vocabulary Discussion about Chromosomes: Centromeres, Telomeres, Histones, Chromatids, Sister Chromatids, Homologous Chromosomes, Somatic Cells, Gametes.

Wednesday:
1.) Angiogenesis HHMI Clip and Colonoscopy Clip from Simpsons.
2.) C. Lab: Cancer Type research based on family history.
Open the powerpoint that says "Cancer Template" and complete the instructions on each slide.

Thursday:
Quick Quiz: Cell cycle steps, get with a partner, and put that onto white board and have person with fewest details describe the details.
1.) Cell Cycle with paper
2.) Cell cycle act out in the classroom.
3.) Cancer Notes.
Cancer sheets share with others.
4.) Cancer key words: Cancer, Malignant, begign,
5.) Review Cell Cycle with videos

Friday:
Answering questions about a specific type of cancer

Monday
Review molecule types and cell cycle with poker/notecards/powerpoint.

Tuesday
1.) Cell Cycle/molecule Test

Wednesday
November 8th
How does DNA control the cell?
DNA to Protein start

Transcription and Translation are coming (ATACGATCTGATC, ATACCGCTCCGCCGTCGACAATACCACT as one code)

Thursday
DNA KHAN Academy

Friday

Biomolecules/DNA Connection

2011-10-20T18:40:00.001-07:00

Monday: 10/24
SWBAT: Reading 6.3 and answering questions in the book.

Tuesday 10/25: SWBAT: Describe the four major categories of organic polymers.
1.) Ecology Test Part Two.
2.) Vocabulary Discussions for the following: Organic, Monomer, Polymer, Protein, Amino Acid, Nucleic Acid, Nucleotide, Carbohydrate, Saccharide, Lipid, Fatty Acid, Hydrophobic, Hydrophilic.
3.) Use Models to show DNA.
4.) Utah Cell Scale Interactive to show the different organic biomolecules.

Wednesday 10/26: SWBAT: Describe the four major categories of organic polymers.
1.) Finish Vocabulary from Wednesday.
2.) Chlorophyll Extraction Lab from Spinach.

Thursday 10/27: SWBAT: Describe the four major categories of organic polymers.
1.) Around the room classification of biomolecules.
2.) Pyramid with Biomolecules thrown in.
3.) DNA building as two teams.
4.) Review cell scale on Utah website.

Friday 10/28: SWBAT: Analyze DNA sequences to determine evolutionary relationships.
1.) DNA sequences evolution lab.

Monday: SWBAT: Complete Graphic Organizer of organic biomolecules using notes.

Finishing Ecology Going into Molecules, DNA structure Mitosis

2011-10-11T17:36:00.000-07:00

Thursday:
Pass Back All, Vocabulary: Photosynthesis, Cellular Respiration, Carbon Cycle, To Casket or Not To Casket
Half Sheet: Would I prefer a casket or not? Why?

Friday:
http://babyinthebend.blogspot.com/2010/05/mikan-cartographer.html
Pyramid Review (5)
Showing kids
Finish Carbon Cycle Books (15 minutes),
Photosynthesis and Cellular Respiration vocabulary (5 minutes),
Algae Fuel (11 minutes)

Monday 10/17
Forrest and Prairie Ecosystem Gizmo
SWBAT: review the major concepts in the IN standards related to ecology.
Pyramid review of ecology vocab.
Study guide over interdependence and matter cycles energy transfer standards.

Tuesday 10/18
SWBAT: Describe how carbon cycles through the biosphere.
Pyramid of ecology vocab.
Ecology Review of questions.

Wednesday 10/19
Ecology Test

Thursday 10/20 Test

Monday 10/24
Sub Macromolecule reading worksheet.

Tuesday 10/25
SWBAT: Describe the structure and function of different biomolecules.
Pyramid vocab review.
Molecule Vocabulary: Nucleic Acids, Nucleotides, Protein, Amino Acids, Enzymes, Carbohydrates, Monosaccharides, Lipids, Glycerol and Fatty Acids

Wednesday 10/26
SWBAT: Describe the structure and function of different macromolecules.
Macromolecule Review: Students act like monomers and come together to form a polymer.
Macromolecule Review ppt and game show
Macromolecule Review Chart

Thursday 10/27
SWBAT: Describe the structure and function of different biomolecules.
Around the Room Macromolecule classification
Macromolecule video
Macromolecule pyramid

Friday 10/28
SWBAT: Describe how DNA shows evolutionary relationships
DNA to Evolution Connection Activity

Thursday 10/27
SWBAT: Describe the evolutionary history of their favorite animal.
Animal Evolution Project

Friday 10/28
SWBAT: Construct a model of DNA.

Monday: SWBAT model how DNA is able to replicate.

Tuesday: SWBAT describe how cells divide.

Ecology, Succession going into molecules

2011-09-16T19:35:00.000-07:00

Friday: 9/16 Graphing Dog to Wolf Data: White boarding the data. Evolution most convincing piece of evidence that species change over time.
Agree Disagree Unsure questions...
Bacteria can become more deadly as the mutate
Giraffes can get longer necks through natural selection
Populations change over time
Humans evolved from ape like ancestors

Monday:
Is it made of cells? Formative Assessment Probe.
-Atoms to Universe Size and Scale Activity, Cutting and pasting into order.
Extra Time:
Agree Disagree Unsure questions...
Bacteria can become more deadly as the mutate
Giraffes can get longer necks through natural selection
Populations change over time
Humans evolved from ape like ancestors

Tuesday 9/20
SWBAT: Explore how energy moves through an ecosystem.
Test, Money as energy demonstration.
Oh Deer Game and Graphing.

Wednesday 9/21: 2 hour delay --> Watch Simpsons evolution video clip/review cell parts.

Thursday 9/22
SWBAT: Describe vocabulary related to standards in ecology.
1.) Money as energy demonstration again.
2.) Vocabulary Development for Ecology: Limiting Factor, Heterotroph, Autotroph, Decomposer, 2nd law of thermodynamics.

Friday: 9/23 Describe vocabulary related to standards in ecology.
SWBAT:
1.) Pyramid Vocabulary Review
2.) Vocabulary Discussion-rest of words (limiting factors, abiotic, biotic, invasive, succession)
3.) Food Chain Links: Basic and Leveled.
4.) Vocabulary Development for Ecology: Limiting Factor, Heterotroph, Autotroph, Decomposer, 2nd law of thermodynamics, photosynthesis, respiration, invasive species, succession, primary species, climax community, other words based on standards.
5.) Invasive Species videos.

9/26
Monday
SWBAT: Create a web of an ecosystem with materials from around New Prairie.

Tuesday 9/27
SWBAT: Describe the process of succession.
1.) Pyramid Vocabulary review
2.) Succession Google Map pictures along SR2
3.) Succession, Catastrophe, Pioneer Species, Intermediate Community, and Climax Community vocabulary.
4.) NOVA Mt. Saint Helens video clip

Wednesday: 9/28
SWBAT: Research and describe what happens when different invasive species invade the Great Lakes ecosystem.
1.) Vocabulary Pyramid Review, boat ballast water video.
2.) Great Lakes Invasive Species Book. Book should answer the questions:

1.) Unaltered Beginning Ecosystem (everything should be peaceful, show the organisms that have not yet been impacted by the invader)
2.) How did it get here? (Show how the invader got to the great lakes region)
3.) What is it doing to the Great Lakes Ecosystem? (show negative impacts of the invader)
4.) What are humans doing about it?

Thursday: 9/29
SWBAT: Connect Succession and Ecology.
-Describe 15 connections between living and nonliving objects in an ecosystem.
-Dune Ecology interconnectedness chart.
-Provide list of pictures to take.

Friday: 9/30
SWBAT: Take connect ecology vocabulary to objects in a forest ecosystem.
1.) Review vocabulary with pyramid.
2.) Show how to take pictures and send them to reason42center@photos.flickr.com

Monday: 10/3
Dunes Ecosystem Connections.

Tuesday 10/4: Snake Invasive Species/Orchard Walk/Reading over the Brochure for the Field Trip
What's going to happen in our hole? Whiteboarding.
Get into groups of four where one person in each group will have a camera for the field trip.

Wednesday 10/5 Indiana Dunes Webquest/Task to complete during the Field Trip.

Thursday 10/6
Succession Field Trip Picture Description, 5 paragraphs about the field trip.

Friday 10/7 Compile images of succession into powerpoint.

Monday:
SWBAT: Predict what happens when there is a change in an ecosystem.
1.) Ecology Gizmo, make, print outs.

Tuesday:
SWBAT: Explain what causes Global Warming, ozone layer depletion.

Wednesday: Study Guide over the Ecology and natural selection standards.

Thursday: Atoms, Molecules, Macromolecules Start.

Study guide over ecology and natural selection standards.

Tuesday
SWBAT: Summarize evidence for evolution using a powerpoint presentation
1.) Evolution of their favorite animal ppt.
2.) Review Questions based on Standards, Pyramid, Millionaire.

Start Prokaryotic vs. Eukaryotic Explore lab with picture and description of each where students determine the differences between the two types of cells.

APE Genius

Classification of leaves.

Cell Membrane, Natural Selection, Ecology, Succession

2011-08-21T17:15:00.000-07:00

SWBAT: Construct a device that carries a bean at least 2 meters (CS 8), and describe the process of natural selection.
1.) Natural Selection Story and Notes
2.) Bean Testing.

SWBAT: Simulate Natural Selection
1.) "The Chips are Down" Pieces of paper natural selection hands on simultation and graphing.

-Finish chips are down lab-Graphing
SWBAT: Describe the difference between natural selection and selective breeding.
1.) Vocabulary: Species, gene, gene pool, mutation, Competition, Speciation, Natural Selection
2.) Natural Selection vs. Selective Breeding moving around the room.
3.) Vocab: Asexual, sexual reproduction, inherited vs. acquired traits.
4.) Pyramid with Natural Selection

SWBAT: Analyze natural selection situations
1.) Natural Selection Computer Simulations. Nowhere to hide, Evolution Lab, Natural Selection Peppered Moths
2.) Students use a grid in their notebooks to analyze the computer situations where natural selection is occuring.
3.) MRSA Video

SWBAT: Distinguish between selective breeding and natural selection.
1.) Review natural selection, dog and wolf video
2.) Selective vs. Natural Selection around the room.
3.) Natural Selection of Antibiotics Video.
4.) Biology Pyramid until the end.

Tuesday 9/6
SWBAT: Describe trends in fossil record and fossilization process.
Finish Natural Selection simulations and grid.
Where did all of the different types of life come from? Not how did life strat.
1.) Fossil Evidence Activity in Notebook under labs/observations.
2.) Fossilization Process-Notes.
3.) Write a book about how a friend of yours became a fossil. 4 pages.

Wednesday 9/7
SWBAT: describe and order the major events in the history of life on earth.
History of earth timeline using string across the room.
Each group gets a specific event in the history of life on earth.
They create a colored pictured that shows exactly what happens at that time.
Then based on the time that it happened, they determine where it goes on a string that is room length.
They use a clothspin to hang their image from the string.

Goal: Recognize and explore trends in the Fossil Record.
Reflection:
Engage "I would like to die next to a river and drown so that I could become a fossil" Agree or Disagree. Why?
1.) Pass back papers.
2.) Fossilization Process

Notes: 1.) Death without decomposition. 2.) Burial under water and sediment. 3.) Over time, minerals replace cells to form a rock that is the same shape as the organism.
Fossilization Process Animation

Friday
A.) Rules of science as a game.
RULES OF THE GAME OF SCIENCE: (From TEACHING YOUR CHILD SCIENCE)
1.) Honesty is the best policy.
2.) Cheating is not allowed. Scientists cannot make up their results.
3.) Don't Take Another Person's word for Something-Check it out yourself. "Show-me physical, logical, evidence, I'm a scientist."
4.) Scientists use Past Discoveries to Improve the Game.
5.) Scientists try to find "Natural" Answers to Questions.
6.) Arguments are settled with Evidence, not with insults.
7.) Nothing is ever known for sure in science.
8.) There are no secrets in science.
9.) Scientists admit when they are wrong.

What Science is NOT, Pseudoscience and Nonscience. (SCIENCE IS LIMITED)
1.) Monsters and Demons, Ghosts and Haunted Houses.
2.) Extrasensory Perception (ESP)
3.) Astrology.
4.) Mythology
5.) Religion

REMEMBER: SCIENCE IS THE DOABLE and TESTABLE. What your eyes can see, hands can touch, ears can hear. Not faith. Not belief.

Monday 9/12
Cell Parts Cards
Finish Vestigial Structures discussion
Vocab: Prokaryotic and Eukaryotic Cells.
Review Natural Selection

Tuesday 9/13
SWBAT: Model divergent evolution using dog and wolf card game.
1.) Dog Card game, answer questions, and graph your results against someone from another group.

Wednesday 9/14 Finish Wolf to Dog Card Game and graph the results.
Theory of Evolution: All life originated as simple prokaryotic cells and has adapted over time to survive in its environment.

Thursday
SWBAT: 9/15 Evolution and Cell Parts Test

Friday: 9/16 Graphing Dog to Wolf Data: White boarding the data. Evolution most convincing piece of evidence that species change over time.
Agree Disagree Unsure questions...
Bacteria can become more deadly as the mutate
Giraffes can get longer necks through natural selection
Populations change over time
Humans evolved from ape like ancestors

Monday:
Atoms to Universe Size and Scale Activity, Cutting and pasting into order.

Tuesday 9/20
SWBAT: Explore how energy moves through an ecosystem.
Test, Money as energy demonstration.
Oh Deer Game and Graphing.

Wednesday 9/21
SWBAT: Describe vocabulary related to standards in ecology.
1.) Money as energy demonstration again.
2.) Vocabulary Development for Ecology: Limiting Factor, Heterotroph, Autotroph, Decomposer, 2nd law of thermodynamics.

Thursday 9/22
SWBAT: Relate autotrophs to evolution.
Outside walk vocabulary chart. (collection of a variety of leaves) for classification.

Friday 9/23
SWBAT: Describe and analyze changes in ecosystems.
Ecology Gizmo.

9/26
SWBAT: Describe how invasive species impact an ecosystem.
Great Lakes Invasive Species Book

SWBAT: Describe the process of succession.
Succession ppt. and notes, Succession walk.

Tuesday: 9/30 Dunes interconnectedness activity.

Wednesday: 10/6
Succession Field Trip.

Thursday: 10/2
Succession Field Trip Picture Description

Left Overs:
Great Lakes Invasive Species

SWBAT: Summarize evidence for evolution using a powerpoint presentation
1.) Evolution of their favorite animal ppt.
2.) Review Questions based on Standards, Pyramid, Millionaire.

Start Prokaryotic vs. Eukaryotic Explore lab with picture and description of each where students determine the differences between the two types of cells.

APE Genius

Classification of leaves.

Cell Parts, Cell Membrane Experiments, Natural Selection Start

2011-08-17T17:57:00.000-07:00

Thursday: 8/18
SWBAT observe the behavior of cells in different salt solutions, set up notebooks.
Monday of second week: (using lab notebook)
1.) Cells in different types of water. Discuss controls and variables.
-Formative Assessment Probe: Basic form of life and is it made of cells.
2.) Potatoes in different locations throughout the room. Four Columns: Liquid mixture #, potatoes in observation, how much salt do you think, explanation. 1 all water, 17 lots of salt. 3-17 variable amounts of salt.
3.) In your observations/lab section of your notebook, list the order you think the cups are from least salty to most salty and why.

Friday: 8/19
SWBAT: describe the functions of a variety of cell parts.
Pyramid Powerpoint
Set up notebooks:
Notebook Guidelines: I'll tell you what to put into your notebook and when. You can add biological observations at any time.
Page One: Table of Contents:
First: 25 Pages (2-30) of Vocabulary,
Second: 31-70 Pages of Notes,
Third: 71-100 Pages of Labs-Reflections,
1.) Inductive reasoning with different things and marking an x next to the things made of cells.
2.) Formative assessment probe: Is it made of cells?
3.) NOTES: Start with parts of a school determine function, and then list the cell part.
4.) VOCABULARY: Cell Parts vocabulary discussion (Cell Membrane, Ribosome, Nucleus, Chloroplast, Cell Wall, Mitochondria, Endoplasmic Reticulum, Cytoplasm, Chromosomes/DNA, all on the chart)
5.) Activity Cell Parts labeling parts of the room with post notes. (Next day, have the large signs on each object)
6.) Vocabulary and Notes: Hypotonic, Isotonic, Hypertonic Solutions Notes and then vocabulary
-Cell Parts random objects analogies.
-Cell Parts pyramid.

Monday 8/22
SWBAT connect functions of cell parts to functions of a variety of objects.
1.) NOTES: Students are given 17 different objects, they then must connect the function of those objects to the functions of a specific organelle.
2.) Game: Cell Parts pyramid.
3.) Cell Parts quiz with analogies.
4.) Cell Parts millionaire/matching.

Tuesday 8/23
SWBAT act out the function of the plasma membrane. Describe structure and function of the plasma membrane. (Active, Passive Transport, Osmosis, Diffusion)
1.) Cell Part Quiz-Analogies
2.) Cell Membrane Role Play (Membrane bilayer, transport protein, sugar, salt sodium and chlorine, water),
3.) Cell Membrane structure and function ppt.
4.) Computer simulations for cell membrane.
5.) Vocabulary Discussion: diffusion, osmosis, active transport, passive transport.
Notes: Cell membrane map.

Wednesday 8/24
-Bean Device Testing, Natural Selection Start

Thursday 8/25
-Toothpicks and Natural Selection

Friday 8/26
-Bean Device Testing Again

Start of 2011

2011-06-02T10:30:00.000-07:00

Monday: 8/15
-Working on filling out a notecard (information). (First and Last Name, something interesting about yourself, favorite science activity, one question for me, on back what is your lifetime ambition)
-Expectations powerpoint.

-Asians, Asian Americans, and Americans: Reading and Answering Questions. Discuss writing utensil procedure. Working on discussion procedure.
-Why I teach Biology. (human health, we all take care of others, understanding the universe)
-Assignment: Get a composition notebook by Wednesday (Put name on it keep it in class, see summer school for divisions).
-Cell Parts and functions analogy handout.
-Is it Alive? Formative Assessment Probe

Wednesday (Computer Lab): Goal determine perceptions of student learning. 8/16
Cell Analogies Handout
Go over computer lab rules (no food or drink, no games, educational purposes only, no proxies)
1.) Beginning of school survey.
2.) Sign up for Freshman Biology on edmodo.com
-Go to edmodo.com
-Insert the code equ292 as our class code.
-Under settings, sign up for notifications as Text Message. (put in your #)
3.) Modalities Worksheet and Grid of different types of learners put name and type of learner on a popsicle stick for drawing names out of a hat and determining groups.
4.) Done? Explore Nobel Prize Cell Parts Game, Malaria Game.

Tuesday: 8/17
Goal: SWBAT determine what happens in the brain when they learn something new.
-Review cell analogies, cell parts and functions.
-Go over turning in work procedure.
-Is it Alive Formative Assessment Probe
-Mindset article reading and discussion.
-How your brain works powerpoint use looseleaf paper

Thursday: 8/18
SWBAT observe the behavior of cells in different salt solutions, set up notebooks.
Monday of second week: (using lab notebook)
Set up notebooks:
Notebook Guidelines: I'll tell you what to put into your notebook and when. You can add biological observations at any time.
Page One: Table of Contents:
First: 25 Pages (2-30) of Vocabulary,
Second: 31-70 Pages of Notes (27-57),
Third: 71-100 Pages of Labs-Reflections (58-80),

1.) Cells in different types of water. Discuss controls and variables.
-Formative Assessment Probe: Basic form of life and is it made of cells.
2.) Potatoes in different locations throughout the room. Four Columns: Liquid mixture #, potatoes in observation, how much salt do you think, explanation. 1 all water, 17 lots of salt. 3-17 variable amounts of salt.
3.) In your observations/lab section of your notebook, list the order you think the cups are from least salty to most salty and why.

Friday: 8/19
SWBAT: describe the functions of a variety of cell parts.
Pyramid Powerpoint
1.) Inductive reasoning with different things and marking an x next to the things made of cells.
2.) Formative assessment probe: Is it made of cells?
3.) NOTES: Start with parts of a school determine function, and then list the cell part.
4.) VOCABULARY: Cell Parts vocabulary discussion (Cell Membrane, Ribosome, Nucleus, Chloroplast, Cell Wall, Mitochondria, Endoplasmic Reticulum, Cytoplasm, Chromosomes/DNA, all on the chart)
5.) Activity Cell Parts labeling parts of the room with post notes. (Next day, have the large signs on each object)
6.) Vocabulary and Notes: Hypotonic, Isotonic, Hypertonic Solutions Notes and then vocabulary
-Cell Parts random objects analogies.
-Cell Parts pyramid.

Monday 8/22
SWBAT connect functions of cell parts to functions of a variety of objects.
1.) NOTES: Students are given 17 different objects, they then must connect the function of those objects to the functions of a specific organelle.
2.) Game: Cell Parts pyramid.
3.) Cell Parts quiz with analogies.
4.) Cell Parts millionaire.

Tuesday 8/23
SWBAT act out the function of the plasma membrane. Describe structure and function of the plasma membrane. (Active, Passive Transport, Osmosis, Diffusion)
1.) Cell Part Quiz-Analogies
2.) Cell Membrane Role Play (Membrane bilayer, transport protein, sugar, salt sodium and chlorine, water),
3.) Cell Membrane structure and function ppt.
4.) Computer simulations for cell membrane.
5.) Vocabulary Discussion: diffusion, osmosis, active transport, passive transport.
Notes: Cell membrane map.

Wednesday 8/24
-Test over cell parts and functions. (emphasis on the cell membrane)
-Unknown tin can activity

Finishing Strong

2011-05-18T18:02:00.000-07:00

Thursday
-Quick Review (5)
-Cell Signal Poker (15)
-Mitosis/Meiosis Review with manipulative-Homologous Chromosomes, Genes, Prophase, Metaphase, Anaphase, Telophase (15)
-Half Sheet ECA Style Question (5)
-Cell Membrane Transport on Teachers' Domain (5)

Friday
-Half Sheet ECA Style Question. Explain two functions of the cell membrane? (5)

-Quick Review (5)
Which Two Organisms are most closely related based on their nucleotide sequences of DNA...
Organism A AATTCCGG
Organism B CCGGTTAA
Organism C ATTTCCGG
Organism D GGAATTTT

-DNA to Protein (3 different times: Original, Insertion, Deletion, Substitution) (25)
-Coal and Oil Formation
-Watch Protein Public Service Announcements (10)
-Lice and Human Evolution Nova Science Now.

Monday
-Half sheet ECA Style Question: Darwin found over five different type of finches on the Galapagos Islands. What is a scientifically valid explanation for how these five finches started?
-Analogous/Homologous
-Acid River Review
-Going over the Chart of everything that is on the test

Tuesday
-Algebra Testing, Analogous/Homologous Find as many examples online as possible.
-Making Pie Charts out of Cell Cycle. Growth One=1 hour 43 Minutes, DNA Copying=3 Minutes, Growth 2=10 Minutes, Prophase=1 minute, Metaphase=0.5 Minutes, Anaphase=0.5 Minutes, Telophase=1 minute, Cytokinesis=1 minute.

Wednesday
-Biology ECA Testing
-Nova Science Now.

Thursday
-Final Survey/Feedback/Opinions

Friday
Final Class Day (Orchard? Going over study guide for final)

Tuesday
Final Exam

Wednesday
Final Exam

Essay Test and Others

2011-05-05T12:23:00.000-07:00

Monday:
Essay Test 100% Day

Tuesday: Mouse Party/Cell Signal Poker

Wednesday: Transcription Translation Video HHMI, Essay Test 91% Day

Thursday: Mouse Breeding with two Carriers. Punnett Square Practice Around the Room.

Friday: Essay Test 81% Day.

Monday: Mouse Party and Punnett Squares.

Tuesday: Analogous vs. Homologous. Essay Test 71% Day. Cell Signal Wagering.

Wednesday: Mitosis vs. Meiosis with Paper and Tournament

Thursday: Essay Test 62% Day. Acid River Review.

Friday: DNA to Protien Mutation Types. Protien Public Service Watching.

Board Games-Antibiotics

2011-04-25T18:49:00.000-07:00

Practice Multiple Choice Questions at the beginning of each period.
Monday:
SWBAT make a board game based on one of the big ideas in biology.
1.) Give groups of students two choices to create a board game about one of the essay questions on next Monday's test.
2.) Students start completing the requirements of the board game. (Add T-Shirt Design), 20 questions, game board, Jingle for the board game, etc. rough draft of the board game on white paper.
SEE RUBRIC Handed out in class.

Tuesday: SWBAT make a decision about the importance/significance of antibiotic use in farm animals. See lesson plan from this link.
1.) Antibiotic survey questions: How many have used them in the last year?
2.) Antibiotic video clips: From CBS. Antibiotic and improved growth in farm animals article.
2.) Scenario

Wednesday: SWBAT make a board game based on one of the big ideas in biology.
1.) Continue working in groups from Monday.

Thursday: SWBAT finish making a board game based on one of the big ideas in biology.
1.) Finish Board games

Friday: SWBAT determine how a cell responds to different stimulus.
1.) Cell Signal Poker

Finishing Ads one week about Homeostasis

2011-04-20T04:30:00.000-07:00

Start each class with some multiple choice ECA review questions

Monday: Finish Ads, save them to a USB drive then I will share with the class.

Tuesday: Homeostasis and Humans activity and worksheet.

Wednesday: Homeostasis and cells in different solutions. Paramecium contractile vacuole in action.
(diffusion, osmosis, active transport)

Thursday: SUB: High school football video from Frontline. Answer questions during the video.

Friday: Homeostasis and heart rate: Resting, Running around and determine how long it takes to get back to resting. Use a line graph to show how the heart rate returns to normal after a period of time from exercising.

Biological Advertisements

2011-04-15T11:11:00.001-07:00

Monday: Students complete an outline for an advertisement for the most important concept in biology.
1.) Quick Process Review
2.) Students pick out one of the most important ideas in all of biology (brainstorm a list with the students)
3.) Watch youtube political ads about Joe Donnelley and Jackie Walorski.
4.) Students complete an outline for their future ad.

Tuesday:
Quick Vocab Review
1.) Students use the outline they completed on Monday to compile images they could use for their advertisements.
2.) Start working in imovie on their advertisements.

Wednesday: (morning sub: Honeycrisp Article and Answering questions)
Quick Vocab Review
Continue Working on Ads.

Thursday: Last Day to work on Ads.

Pixton Misconception Comics

2011-04-15T04:57:00.000-07:00

Students: Make a comment to this post that includes a your names and a link to your comic.
For example:
Name: Billy Waldron
Title: Adoption Controversy
Comic Link: http://www.pixton.com/comic/t7a4w0z5

Well Water Map

2011-03-31T11:16:00.001-07:00

Well Water Testing-Leading to Spring Break, and After

2011-03-22T17:47:00.000-07:00

Monday:
Pond Ecosystem Gizmo

Tuesday:
Practice Water Testing

Wednesday:
Actual Water Testing

Thursday:
Uploading Data to wellhead.michianastem.org

Friday:
Presentation of Well Data

Monday: (at the start of each period. --> Practice Multiple Choice Test Questions from NY Reagents Test)
Test on Thursday:
Protein Structure and Function
What are the different structures proteins can have? Are the resilient? What are some threats to those proteins?
Be able to come up with the structure of a protein based on its function.
Be able to match and describe different proteins with their jobs.
Taking a DNA sequence to a protein,
What is the amino acid code for a protein with gene sequence of TATACAAAGGGCCCATC?
Sugar break down:
What does our body do to food to get energy? What is ATP, fermentation, respiration?
How does our body treat artificial sweeteners?
What are the five kingdoms of life?
What are the characteristics that set those kingdoms apart?
What is homeostasis?
Explain how surface area helps organisms survive (3 examples)?

Tuesday:
Making stuff cleaner video clip of garbage into electricity.
Go over study guide.
pH and Protein Demonstration
Review Biology Poker

Wednesday:
Test, Post Survey, Submit Well information online wiki.

Thursday: Ape Genius Video

Friday: Ape Genius Video, Go over Wednesday Test

Monday, Tuesday, Wednesday: Homeostasis Interactive, Planting Trees, Apple Tree Vocabulary: Scionwood, rootstock, cloning, patents.

Thursday: Pixton.com misconceptions
Students answer a series of True False Questions related to common misconceptions in biology.
Based on the questions they got wrong they are going to create a pixton comic that helps others understand the situation.
They may: Develop a conversation between two people where one explains to the other the truth about the situation.
Or they may: Develop a comic demonstrating the appropriate understanding of the situation.

Friday: Pixton.com misconceptions finish and view.

Protein Structure and Function-Water Testing

2011-03-16T06:16:00.000-07:00

Wednesday: SWBAT: Show that protein structures are sensitive via protein protection PSA's
1.) Students work to finalize PSA's
2.) Students present PSA's to the class.

Thursday: SWBAT: Describe how nitrate impact hemoglobin development and lead to blue baby syndrome.
Finish the PSA's
1.) Read article about blue baby syndrome.
2.) Explore the wellhead.michianastem.org wiki and see other schools' information and regional map.

Friday: SWBAT: Relate structures of proteins to functions of proteins.
1.) Students are given pipe cleaners and must create protein structures that are appropriate for a given function.
2.) Functions:
Provide a pathway to allow very large particles to move through the cell membrane.-Membrane Protein
Provide a pathway to allow very small particles to move through the cell membrane.-Membrane Protein
Attach to a bacteria or virus.-Antibody
Break a molecule into two parts.-Lysosome Enzyme
Break a molecule into three parts.-Lysosome Enzyme
Bring two molecules together.-Enzyme
Bring three molecules together.-Enzyme
Absorb nutrients for the cell.-Cilia
Move a cell forward.-Flagella
Hold and Carry Oxygen.-Hemoglobin
Attract mates and keep you warm. Hair (Keratin)
Build bones.-Collagen
Receive Signals for the cell.-Receptor Protein

Monday: SWBAT Complete water testing on control samples.

Tuesday: SWBAT complete water testing on water samples from home.

Wednesday: SWBAT insert data from water testing into wikipage.

Thursday:

Sugar Metabolism, Artificial Sweeteners, Frog Video, into Protein PSA's

2011-03-04T09:15:00.001-08:00

Molecules, Cells, Cell Chemistry

Monday: SWBAT: Determine differences in ability of sensing artificial sweeteners.
1.) Review Glucose Breakdown (Metabolism, Glycolysis, Respiration)
2.) Artificial Sweetener Taste Tasting (Truvia, Saccharin, Aspartame, Splenda, Sugar)
3.) Compare students taste of sugar with the other sweeteners.
4.) Group Students based on tasting of each sweetener.

Tuesday: SWBAT: Investigate one artifical sweetener.
1.) Review discussion of metabolism, sugar breakdown.
2.) Artificial Sweetener ppts.

Wednesday: SWBAT: Summarize glucose breakdown by creating a short story.
1.) Review discussion of metabolism, sugar breakdown.
2.) Sugar Breakdown book creation.

Thursday and Friday: Sub, Frog NOVA Video.

Monday SWBAT: Describe the primary, secondary, and tertiary structures of protein.
Tuesday SWBAT: Describe the threats to protein structure and function and create a PSA for protein protection.
Wednesday: Show Blue Baby Syndrome information.

Natural Selection and Reaction Time, Classification, Sugar Breakdown

2011-02-16T13:01:00.000-08:00

Monday
1.) Go over essay test that will be in mid to late April.
2.) Quiz on Wednesday: Zebra Fish Development, Stem Cells, Easy Punnett Squares.
3.) Finish your bioeyes booklet

Tuesday
Goal: determine reaction time and relate it to Natural Selection.
1.) Discuss test on Tuesday: Stem Cells, Field Trip, Parkinsons.
2.) Review Cards
3.)What do you think causes differences in reaction time between individuals? What question would you ask people?
4.) Reaction Time calculations Students complete their reaction time 10 times and determine the average.
5.) List from fastest to slowest. (determine mode, median, mean with and without outliers)

Wednesday
1.) Administer Quiz
2.) Khan Academy Video because of a sub

Thursday
1.) Nerve Cells Review
2.) Review Cards
3.) Computer Reaction Time Testing
4.) Questionairre Completion.

Friday
1.) Compilation of Data, Conclusions? Sorting Organism Classification Cards.

Monday
SWBAT: Distinguish between the 5 major kingdoms of life.
1.) Shoe Classification Introduction.
2.) Organism classification cards.
2.) Protist, Monera, Fungi, Planae, Animal Vocabulary.
3.) Give students a card and have them walk around the room to make classes.
4.) Astrobiology connection.
Test Thursday Over: Nerve Functions: Receptor Protein, Neurotransmitter, Synapse. Five Kingdoms, Stem Cells (how they become different types of cells).

Tuesday
SWBAT: describe the importance of surface area.
1.) Tree of life-Review.
2.) Surface Area Lesson: Examine the differences between the paper, paper towels, toilet paper using dissection scopes.
3.) Utah Genetics Cilia of digestive system stem cell development.
4.) Gecko hairs NOVA Making Things Smarter: Segment 3 Gecko Hairs.

Wednesday
1.) Know the five kingdoms quiz.
2.) Artificial Sugar Taste Testing.

Thursday
Test
Sugar Taste Tasting?

Friday
Sugar Metabolism Notes
Monday
Sugar Metabolism Review

Tuesday
Artificial Sweetener Powerpoint

Wednesday
Sugar Breakdown Quiz

Thursday-Friday
Frog Video on Nature

Monday-Tuesday:
Antibiotics in Sharks: NOVA: Making things Smarter, Antibiotics in animals.
Protein Powerpoint go over.
Protein PSA's/Posters
Bluebaby Syndrome.

Post Field Trip-Leading to Bioeyes

2011-02-08T12:04:00.000-08:00

Wednesday:
SWBAT: Connect Field Trip experience to biology class.
Group Brainstorm:
I hadn't seen before...
What related to biology class...
Ways to improve the trip (that are under my control)...
Vocabulary: Stimulus-Response, Pavlov's Dog Online.

Thursday:
Bioeyes flip book and reading about bioeyes.

Friday:
Stem Cell Quiz
Bioeyes Crossword Puzzle-Test Cross Vocabulary.

Monday: 2/14
Bioeyes Day One Pick out Parents

Tuesday 2/15
Bioeyes Day Two

Wednesday 2/16
Bioeyes Day Three

Thursday 2/17
Bioeyes Day Four

Friday 2/18
Bioeyes Day Five

Monday 2/21-
Introduction to Essay Test, Compile pictures for iMovie Presentations.

Meiosis, Genetics, Mendel

2010-12-21T07:18:00.000-08:00

Monday 1/3:
Go over Final Exam item by item, Meiosis Acting Out.

Tuesday: Goal: Connect experimental results to genetic explanations.
Mendel Experiments Story Telling about mating.
1.) Mouse Gizmo Experiments
-Describe Parents, hypothesis, results, and conclusion.
2.) Genetics Exploration with Mice and Test experiments.
3.) Start Vocabulary descriptions.

Wednesday: Goal: Use appropriate terminology to describe genetic inheritance.
1.) Review: Homologous Chromosomes in Somatic Cells, genes on chromosomes.
2.) Vocabulary: Genotype, Phenotype, Allele, Gene, Gene Activation, Gene Suppression, Dominant, Recessive, Heterozygous, hybrid, carrier, Homozygous, pure breed, F1, F2, Youtube Genetics Playlist.
3.) Utah "Observable Traits" Slideshow applying traits information. Create a Table of trait, phenotypes, me, mom, dad, brothers, sisters.
-9 Traits.
Observable Traits Chart for this activity. http://www.sonic.net/~nbs/projects/bio115l/form.html

Thursday
Meiosis with paper chromosomes and Punnet Square problems with the one mouse traits.

Friday: Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.

Monday 1/10:
Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the reality.
4.) Share results.
5.) Sex chromosome punnett square.

Tuesday: GOAL: describe differences between mitosis and meiosis.
1.) Punnet Square Practice Problem.
2.) Mitosis vs. Meiosis around room.
3.) Youtube Genetics Playlist on jgensic's channel.
4.) Lecture: Sex determination.
5.) Sex chromosome problems. XXX, XO, XYY, XXY

Wednesday:GOAL: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.

Thursday: GOAL: Students describe Egg donation process and ethics.
1.) Article and Scenario.

Friday:
-Meiosis with your own chromosomes and combination of gametes.
-Mitosis vs. Meiosis Around the room.

Tuesday: demonstrate meiosis with paper chromosomes.
-Explore Next Generation

Wednesday
GOAL: Describe how karyotyping works to determine chromosomal abnormalities.
1.) Show sex determination punnett square. Show abnormalities with sex determination.
2.) Have students complete online karyotypes to determine abnormalities.
First Complete Utah Karyotype
Second Complete Explorelearning.com Gizmo Karyotype: Figure out one person.

Thursday:
-Go over genetics study guides.
-Nicotine Addiction Pedigree.

Wednesday:
Notes on Mendel:
Start with experiment: TT crossed with tt, then cross Tt with Tt.
Austrian Monk, July 20, 1822 – January 6, 1884
1865 and 1866 which was "re-discovered" in 1900
29,000 pea plants tested.
Law of Segregation and Law of Independent Assortment as vocabulary.
Work into dihybrid crosses until bell.

Wednesday:
Vocabulary Review, Another Dihybrid Cross, Nicotine Addiction Pedigree Investigator.

Thursday:
Test Concepts: Genetics, Meiosis vs. Mitosis, Gametes vs. Somatic, Mendel.

Friday: Test.

Monday:
Tuesday: Cystic Fibrosis situation and article.

Extra: Mendel: Mendel meets Watson and Crick skits.
-Mendel Notes: You tube videos.
-Law of Segregation and Independent assortments.
Xtranormal: Mendel meets Darwin.
Key points:
-They never actually met.
-Darwin: came up with Natural Selection
-Mendel: came up with rules of inheritance
-Darwin's natural selection said that favorable traits were passed on.
-Mendel discovered how these traits are passed on.
-Mendel monk, Darwin English Naturalist.
-Mendel kept very detailed records

Goal: Describe Mendel's experiments, describe the process of meiosis.
1.) Mendels's Experiments interactive http://www2.edc.org/weblabs/Mendel/mendel.html
2.) Doing Punnett Squares around the room.

Monday:
Going into stem cells, embryo development, after meiosis in terms of organismal.

Finals Week

2010-12-12T16:30:00.000-08:00

M: Snow Day?
T: Khanacademy.org 2 biology videos.
W: Textbook molecule sheet completion
R: Final for 1, 3, and 5
F: Final for 2, 4, and 6

Rudolph, Food Inc., Connections Activities

2010-12-07T08:55:00.000-08:00

Monday:
Rudolph and Natural Selection

Tuesday and Wednesday:
Food Inc: Connecting Food production to Natural Selection, Genes, and Ecology.

Thursday:
Pond Ecosystem Gizmos

Friday: 6 paragraph put together about the molecule types.

Finishing HPV, Test, going to Endosymbiosis

2010-11-28T10:54:00.000-08:00

Nov. 29th: Review Cell Cycle, Transcription and Translation, HPV and Gardasil Vaccine.
Nov. 30th: Jeopardy Review for Test over (make Jeopardy Game)
Dec. 1st: Test over Transcription, Translation, HPV, Gardasil, (Cummulative: Cell Parts, Cell Cycle, Cancer, Ecosystems, Evolution) (Make Test)
Dec. 2nd: Endosymbiosis Notes and Show me you understand. Final Exam Study Guide pass out. (Make Final Exam Study Guide)
Dec. 3rd Endosymbiosis. Show me you understand presentations.

Protein Synthesis, Growth Hormone Scenario

2010-11-14T07:56:00.000-08:00

Driving Problem:
Tay Sachs Disease:
Symptoms: relentless deterioration of mental and physical abilities occurs. The child becomes blind, deaf, and unable to swallow. Muscles begin to atrophy and paralysis sets in. Death usually occurs before the age of 4. What do you think causes this? Most common among Jewish people.

Monday: SWBAT describe how a DNA gene codes for the production of a protein.
1.) Questioning Review
2.) Show how to do transcription and translation with the paper models.
3.) Students complete the transcription and translation in pairs.
4.) Finish working on Darwin, Watson, and Crick Skits.

Tuesday: SWBAT reenact a skit where Darwin, Watson, and Crick all meet and discuss their findings.
1.) Questioning Review-Transcription, Translation of a DNA code.
2.) Darwin Skits
3.) Transcription, Translation Tournament.

Wednesday: SWBAT describe how the DNA code converts into a protein.
1.) Quiz
2.) Growth Hormone, Scenario.
3.) Mutation Types on different desks.

Thursday: SWBAT differentiate between the types DNA, RNA, transcription and translation.
1.) Classification of phrases as DNA, RNA, protein, replication,transcription and translation by going around the room.
2.) Review DNA Mutation Types

Friday: SWBAT research a particular type of single gene mutation

1.) DNA controls a cell, how?
-It uses the force to control actions.
-It provides a code that determines the structure of lipids that control reactions throughout the cell.
-It provides a code that determines the structure of proteins that control reactions throughout the cell.
-It provides a code that determines the structure of carbohydrates the control reactions throughout the cell.
FACTS:
DNA too large to get out of the nucleus. But still controls the cell. How?

Translation and Transcription Notes.
Step 1: Cell gets a signal that a certain protein needs to be made.
Step 2: DNA is unwound and transcribed into a mRNA molecule. (gene activation)
Step 3: mRNA carries DNA's message to the ribosome.
Step 4: mRNA is translated at the ribosome into a protein by tRNA bringing amino acids to the ribosome.
Vocab: Transcription, Translation, mRNA, tRNA, Central Dogma,

Driving Question
1.) Prior Knowledge Question:
Is all of the DNA in a cell active in coding for protein?
a.) No, only certain parts of the DNA are active, this determines the type of cell.
b.) No, only certain parts of the DNA are active, this is determined by the individual.
c.) Yes, all the DNA is active, this is what makes cells different from one another.
d.) Yes, all the DNA is active, this is what makes individuals different from one another.

Review: Transcription and Translation computer interactives.
1.) Follow this series of links to work out steps to transcription and translation.
2.) Utah Genetics
3.) Teacher's Domain
4.) Explorelearning.com: Protein Synthesis Use a login and password.
5.) Another Transcription Animation
6.) Another translation animation.

Friday 11/19
Start single gene mutation research.

Topics...
Type 1 Galactosemia
Sickle Cell Anemia
Cystic Fibrosis
Tay-Sachs
Phenylketonuria
Glycogen Storage Disease Type I
Familial hypercholesterolemia (LDL receptor) cholesterol
Huntington's Disease
Polycystic kidney disease
Hemophilia A
Lesch–Nyhan syndrome
Canavan Disease
Marfan Syndrome
Norrie Disease

Monday:
1.) Translation and Transcription role play with DNA (ATTACGATCTGCACAAGATCCT) codes in groups. Sheet for DNA Helicase, RNA Polymerase, and then ribosome, and tRNA (one carrying methionine/aug, leucine/gac, aspartic acid/gug, valine/uuc, phenylalanine/uuc, and stop/uag.
2.) Genetic Disease Presentations. Other students record the # of chromosome and the protein that is impacted.

Finishing Cell Cycle Going into DNA to Proteins

2010-11-03T07:21:00.000-07:00

11/4 Thursday
1.) Cancer sheets share with others.
2.) Cancer key words: Malignant, begign,
3.) Review Cell Cycle with paper and yarn as cell membrane.

11/5 Friday:
1.) Cell Cycle Test

11/8 Monday:
Tay Sachs Disease:
Symptoms: relentless deterioration of mental and physical abilities occurs. The child becomes blind, deaf, and unable to swallow. Muscles begin to atrophy and paralysis sets in. Death usually occurs before the age of 4. What do you think causes this? Most common among Jewish people.

Goal: Students describe how DNA provides template for proteins.
1.) DNA controls a cell, how?
-It uses the force to control actions.
-It provides a code that determines the structure of lipids that control reactions throughout the cell.
-It provides a code that determines the structure of proteins that control reactions throughout the cell.
-It provides a code that determines the structure of carbohydrates the control reactions throughout the cell.
FACTS:
DNA too large to get out of the nucleus. But still controls the cell. How?

2.) Transcription and Translation Videos HHMI.
3.) Translation and Transcription Notes.
Step 1: Cell gets a signal that a certain protein needs to be made.
Step 2: DNA is unwound and transcribed into a mRNA molecule. (gene activation)
Step 3: mRNA carries DNA's message to the ribosome.
Step 4: mRNA is translated at the ribosome into a protein by tRNA bringing amino acids to the ribosome.
Vocab: Transcription, Translation, mRNA, tRNA, Central Dogma,

4.) Translation and Transcription role play with DNA (ATTACGATCTGCACAAGATCCT) codes in groups. Sheet for DNA Helicase, RNA Polymerase, and then ribosome, and tRNA (one carrying methionine/aug, leucine/gac, aspartic acid/gug, valine/uuc, phenylalanine/uuc, and stop/uag.

11/9 Tuesday:
Substitute: Review Cell Cycle with Cell Cycle Gizmo

11/10 Wednesday:
Review: Transcription and Translation.
1.) Prior Knowledge Question:
Is all of the DNA in a cell active in coding for protein?
a.) No, only certain parts of the DNA are active, this determines the type of cell.
b.) No, only certain parts of the DNA are active, this is determined by the individual.
c.) Yes, all the DNA is active, this is what makes cells different from one another.
d.) Yes, all the DNA is active, this is what makes individuals different from one another.
2.) Transcription and Translation role play review.
3.) Transcription and Translation worksheet.

11/12 Thursday:
Review: Transcription and Translation computer interactives.
1.) Follow this series of links to work out steps to transcription and translation.
2.) Utah Genetics
3.) Teacher's Domain
4.) Explorelearning.com: Protein Synthesis Use a login and password.
5.) Another Transcription Animation
6.) Another translation animation.

11/13 Friday:
Quiz: Transcription and Translation.
Start single gene mutation research.

Topics...
Type 1 Galactosemia
Sickle Cell Anemia
Cystic Fibrosis
Tay-Sachs
Phenylketonuria
Glycogen Storage Disease Type I
Familial hypercholesterolemia (LDL receptor) cholesterol
Huntington's Disease
Polycystic kidney disease
Hemophilia A
Lesch–Nyhan syndrome
Canavan Disease
Marfan Syndrome
Norrie Disease

11/16 Monday:
Genetic Disease Presentations?

11/17 Tuesday:
Computer Lab Mutation impacts

Lamarck into DNA, Cell Cycle and Cancer

2010-10-21T07:28:00.000-07:00

Monday 10/25
SWBAT: Distinguish between Darwin and Lamarck's views on the formation of species.
1.) Darwin video clips from teacher's domain.
2.) Review inherited vs. acquired traits.
3.) T chart for Darwin and Lamarck
4.) Going around the room classifying statements as Lamarck or Darwin statements.

Tuesday: 10/26
Goal: Describe Structure and Function of DNA.
1.) Formative Assessment
When you examine the DNA inside a skin cell on your finger and examine the DNA in a muscle cell in your heart, what will you find?
a.) They have different DNA because they look different.
b.) They have different DNA because they do different jobs, one protects and one pumps.
c.) They have the same DNA because they are from the same individual.
d.) They have the same DNA because they are both from a human.
Socratic Discussion.
2.) Notes on Basic Development: Fertilization, Cell Division, Differentiation.
3.) Building DNA molecule models: Two strands that are complementary. Using old models. (14 sets) TACGATCTGATC (Totals of 14 T's, 14 A's, 10 C's, 10 G's) 48 total.

Tuesday
Goal: Describe the process of replication.
1.) Describe and model the process of replication of DNA.
Steps to the race:
a.) DNA helicase separates the DNA strands
b.) DNA Polymerase brings in spare nucleotides to create two strands.
c.) Practice in your pairs to go as quickly as possible.
d.) Go against one another

Wednesday
Goal: Describe the process of replication.
1.) Replication Tournament
2.) Nobel Prize DNA game.
3.) Explorelearning Replication interactive.

Thursday
Goal: Describe the cell cycle.
1.) Notes: Cell Cycle: Growth 1, Synthesis, Growth 2, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis.
2.) Cell Cycle Act out with the paper chromosomes (I describe the stages)

Friday
Goal: Describe the cell cycle.
1.) Cell Cycle Practice with chromosomes.
2.) Cell Cycle Ordering on paper.
3.) DNA Replication as a class with Poster Board Cut outs for speed.
4.) Add mitosis, interphase, more details to cell cycle notes
5.) Cell Cycle Timing Activity

Monday
Goal: act out cell cycle.
1.) Cell cycle ordering with pieces of paper.
2.) Cell cycle roll play.
3.) Cell Cycle reading 8.2 and 8.3 notetaking and reflection on the back.
4.) Problems with the cell cycle?

Tuesday
1.) Cell Cycle with pieces of paper.
2.) DNA Replication, Structure and Quiz.
3.) Vocabulary Discussion about Chromosomes: Centromeres, Telomeres, Histones, Chromatids, Sister Chromatids, Homologous Chromosomes, Somatic Cells, Gametes.

Wednesday:
1.) Angiogenesis HHMI Clip and Colonoscopy Clip from Simpsons.
2.) C. Lab: Cancer Type research based on family history.
Open the powerpoint that says "Cancer Template" and complete the instructions on each slide.

Thursday:
1.) Cancer sheets share with others.
2.) Cancer key words: Malignant, begign,
3.) Review Cell Cycle

Friday:
1.) Cell Cycle Test

Monday November 8th
How does DNA control the cell?
DNA to Protein start

Tuesday: Cell Cycle Gizmo

Transcription and Translation are coming (ATACGATCTGATC, ATACCGCTCCGCCGTCGACAATACCACT as one code)

Biomolecules, Connecting to Evolution

2010-10-12T04:31:00.000-07:00

Tuesday 10/12: Ecology Test Part One 2 hour delay shorten classes.

Wednesday 10/13: SWBAT: Describe the four major categories of organic polymers.
1.) Ecology Test Part Two.
2.) Vocabulary Discussions for the following: Organic, Monomer, Polymer, Protein, Amino Acid, Nucleic Acid, Nucleotide, Carbohydrate, Saccharide, Lipid, Fatty Acid, Hydrophobic, Hydrophilic.
3.) Use Models to show DNA.
4.) Utah Cell Scale Interactive to show the different organic biomolecules.

Thursday 10/14: SWBAT: Describe the four major categories of organic polymers.
1.) Finish Vocabulary from Wednesday.
2.) Chlorophyll Extraction Lab.
3.) Walking to the orchard?

Monday 10/18: SWBAT: Describe the four major categories of organic polymers.
1.) Around the room classification of biomolecules.
2.) Pyramid with Biomolecules thrown in.
3.) DNA building as two teams.
4.) Review cell scale on Utah website.

Tuesday 10/19: SWBAT: Analyze DNA sequences to determine evolutionary relationships.
1.) DNA sequences evolution lab.

Wednesday 10/20: SWBAT: Act out a simulation for Wolves speciating into wolves.
1.) Card Game description, start playing.

Thursday: 10/21 SWBAT: Act out a simulation for Wolves speciating into wolves.
1.) Finish Card Game, answer questions.

Friday: SWBAT: Complete Graphic Organizer of organic biomolecules using notes.

Finishing Ecology reconnecting to Evolution.

2010-09-28T17:26:00.000-07:00

Thursday: 9/30
SWBAT: Summarize Ecology Field Trip with powerpoint presentation.
1.) Computer Lab and Making presentations.

Friday: 10/1
SWBAT: Summarize Field Trip with a Five Paragraph essay.
Vocabulary: Biodiversity, Abiotic, Biotic.
1.) 5 Paragraphs about field trip. (Introduction, 3 body paragraphs, Conclusion/suggestions for improvement)

Monday: 10/4
SWBAT: Predict what happens when there is a change in an ecosystem.
Cycle Survey
1.) Ecology Gizmo, make, print outs.

Tuesday: Go over study guide to large ecology
SWBAT: Distinguish between photosynthesis and cellular respiration.
1.) Graphic Organizer.
2.) Carbon Cycle activity and notes.
3.) Plants and Snails overview.

Wednesday:
SWBAT: Describe how matter cycles through their environment while energy flows through the environment.
1.) Carbon Cycle Online Interactive.
2.) Carbon Cycle Acting out in class.
3.) Plants and Snails Gizmo.

Thursday:
SWBAT: Describe the premise of the movie Inconvenient Truth
1.) Greenhouse gizmo viewing.
2.) Inconvienient Truth clip

Friday:
SWBAT: demonstrate understanding of ecology with dunes connectedness activity.
Dunes connectedness chart to recap ecology standards.

Monday:
Ecology Test Review, Cycles, 10% Rule, Biodiversity, Connections, Vocabulary, Succession.

Tuesday: Ecology Standards Test.

Wednesday
SWBAT: act out speciation through a modeling card game.
Start Wolf to Dog card game.

Thursday:
SWBAT: act out speciation through a modeling card game.
Finish Wolf to Dog card game.

Friday:
SWBAT: Distinguish between Darwin, Lamarck, and Creationist ideas.
Darwin clip from teacher's domain.
Darwin vs. Lamarck vs. Creationist around the room classification of statements.

Monday: Extended evolution concepts...
Vocabulary: Bottleneck effects, genetic drift, adaptive radiation.

Tuesday:
SWBAT: Horse Natural Selection.

Wednesday:
SWBAT: Evolution TEST

Thursday
SWBAT: Describe the structure of the atom and how atoms interact to form compounds/molecules. (atom ppt., hydrophobic, hydrophilic)

Ecology

2010-09-20T17:31:00.000-07:00

Monday: 9/20 (Get Competition, Everything connected Big idea)
SWBAT: Describe how populations naturally fluctuate over time.
1.) Money as energy demonstration.
2.) Oh Deer Game and Graphing.

Tuesday: 9/21
SWBAT: Describe and model how energy flows through an ecosystem.
1.) Money as energy demonstration again. Energy and pieces of a pie.
2.) Food Chain Links: Basic and Leveled.
2.) Vocabulary Development for Ecology: Limiting Factor, Heterotroph, Autotroph, Decomposer, 2nd law of thermodynamics, photosynthesis, respiration, invasive species, succession, primary species, climax community, other words based on standards.

Wednesday: 9/22
SWBAT: Describe 15 connections between living and nonliving objects in an ecosystem.
Ecology interconnectedness chart.

THursday: 9/23
SWBAT: Describe the process of succession.
1.) Pyramid Vocabulary review
2.) Succession Google Map pictures along SR2
3.) Succession, Catastrophe, Pioneer Species, Intermediate Community, and Climax Community vocabulary.
4.) NOVA Mt. Saint Helens video clip

Friday: 9/25
SWBAT: Research and describe what happens when different invasive species invade the Great Lakes ecosystem.
1.) Vocabulary Pyramid Review, boat ballast water video.
2.) Great Lakes Invasive Species Book. Book should answer the questions:

Unaltered Beginning Ecosystem
How did it get here?
What is it doing to the Great Lakes Ecosystem?
What are humans doing about it?

Monday: 9/27
SWBAT: Connect Succession and Ecology.
-Describe 15 connections between living and nonliving objects in an ecosystem.
-Dune Ecology interconnectedness chart.
-Provide list of pictures to take.

Tuesday: 9/28
SWBAT: Take connect ecology vocabulary to objects in a forest ecosystem.
1.) Review vocabulary with pyramid.
2.) Show how to take pictures and send them to reason42center@photos.flickr.com

Wednesday: 9/29 Dunes field trip.

Thursday: 10/2
Succession Field Trip Picture Description, 5 paragraphs about the field trip.

Friday 10/3
SWBAT: Predict what happens when there is a change in an ecosystem.
1.) Ecology Gizmo, make, print outs.

Left Overs:

Dog Card Game
1.) Dog Card game, answer questions, and graph your results against someone from another group.

Evolution into Ecology

2010-09-02T17:49:00.000-07:00

Friday: (B.1.31)
1.) Vocabulary: Species, gene, gene pool, mutation, Competition, Speciation, Natural Selection
2.) Bean Device Testing again, Natural Selection Quiz.
3.) Vocab: Asexual, sexual reproduction, inherited vs. acquired traits.
4.) Pyramid with Natural Selection

Tuesday: 9/7 (B.1.31) Describe Natural Selection process and distinguish it from artificial selection.
1.) Pyramid Quick Start,
2.) Story of Snake turning over to play dead.
2.) Natural Selection Today Video
2.) Natural vs. Selective Breeding around the room.
3.) Finish and review vocabulary from Friday. (Asexual, sexual reproduction, inherited vs. acquired traits.)
4.) Hot Calling Activity

Wednesday: 9/8-SWBAT-Describe how fossils form and observe patterns in the fossil record.
1.) Fossil Evidence Activity in Notebook under labs/observations.
2.) Fossilization Process-Notes.
3.) Write a book about how a friend of yours became a fossil. 4 pages.

Thursday 9/9
Sub: Cell Parts Video

Friday: 9/10
Goal: Recognize and explore trends in the Fossil Record.
Reflection:
Engage "I would like to die next to a river and drown so that I could become a fossil" Agree or Disagree. Why?
1.) Pass back papers.
2.) Fossilization Process

Notes: 1.) Death without decomposition. 2.) Burial under water and sediment. 3.) Over time, minerals replace cells to form a rock that is the same shape as the organism.
Fossilization Process Animation

2.) Story About a friend being fossilized.

3.) Rules of science as a game.
RULES OF THE GAME OF SCIENCE: (From TEACHING YOUR CHILD SCIENCE)
1.) Honesty is the best policy.
2.) Cheating is not allowed. Scientists cannot make up their results.
3.) Don't Take Another Person's word for Something-Check it out yourself. "Show-me physical, logical, evidence, I'm a scientist."
4.) Scientists use Past Discoveries to Improve the Game.
5.) Scientists try to find "Natural" Answers to Questions.
6.) Arguments are settled with Evidence, not with insults.
7.) Nothing is ever known for sure in science.
8.) There are no secrets in science.
9.) Scientists admit when they are wrong.

What Science is NOT, Pseudoscience and Nonscience. (SCIENCE IS LIMITED)
1.) Monsters and Demons, Ghosts and Haunted Houses.
2.) Extrasensory Perception (ESP)
3.) Astrology.
4.) Mythology
5.) Religion

REMEMBER: SCIENCE IS THE DOABLE and TESTABLE. What your eyes can see, hands can touch, ears can hear. Not faith. Not belief.

Monday 9/13
Goal: Describe four attributes of a scientific theory.
1.) Earth Timeline.
2.) Simpsons Evolution Opening as review.

Tuesday 9/14
Goal: Students describe three types of evidence for evolution
VOCABULARY:(Anatomical Evidence: Homologs, Analogs, Vestigial. Biochemical Evidence: DNA Similarities, Protein Similarities. Behavorial Evidence: Acting in ways to reproduce more)
1.) Review theory attributes.
Notes on main Question "How did all of the forms of life get here?"
-Pre-1859 Thought
-Darwin's finches
-Darwin's Book
-Current Thought
2.) Picture of fertile vs. infertile women
3.) Notes on vocabulary.

Wednesday 9/15
Sub: Wolf to Dog Video and Questions

Thursday
SWBAT: Distinguish between Darwinian Evolution, Lamarckian Evolution, and Biblical Literalism.

1.) Set-up graphic organizer with categories of anatomical, biochemical, behaviorial, and fossil evolution evidence. Students then go around the room and classify pieces of evidence in one of the categories.

2.) Creationism, Darwin, Lamarck Notes: Darwin vs. Lamarck Classification of statements. How old is earth? Did we evolve from Monkeys? What traits are inherited? Is there a God? Are humans the best species? Chart comparing Creationism, Evolution.
3.)Earth Timeline Video History of earth youtube video.
4.) Reading and notes on Darwin's theory. (pg. 393-396)

Friday 9/17
Final test of bean device, Darwin vs. Lamarck, Simpsons Clip.
Attributes of a scientific theory.
1.) Based on physical evidence.
2.) Falsifiable.
3.) Predicts situations.
4.) Missing material from the rest of the week.

Monday: 9/20 (Get Competition, Everything connected Big idea)
1.) Money as energy demonstration.
2.) Oh Deer Game and Graphing.

Tuesday: 9/21
1.) Money as energy demonstration again.
2.) Vocabulary Development for Ecology: Limiting Factor, Heterotroph, Autotroph, Decomposer, 2nd law of thermodynamics, photosynthesis, respiration, other words based on standards.

Wednesday: 9/22
1.) Outside walk vocabulary chart/scavenger hunt (collection of a variety of leaves) for classification.

Thursday: 9/23
1.) Ecology Gizmo, make, print outs.

Friday: 9/24
Ecology interconnectedness chart.

Monday: 9/27
Great Lakes Invasive Species Book.

Tuesday: 9/28
Succession ppt. and notes, pyramid.

Wednesday: 9/29 Dunes field trip.

Thursday: 10/2
Succession Field Trip Picture Description

Left Overs:
Great Lakes Invasive Species

Dog Card Game
1.) Dog Card game, answer questions, and graph your results against someone from another group.

Mystery container picture drawing. Rules of Science

Start Prokaryotic vs. Eukaryotic Explore lab with picture and description of each where students determine the differences between the two types of cells.

APE Genius

Classification of leaves.

Evolution Agree/Disagree, move around the room.

Monday 9/20
Goal: describe the different mechanisms of evolution.
-Review the 4 parts of Natural Selection, 4 attributes of a scientific theory.
1.) Read and notes pg. 407-413.
2.) Complete Graphic Organizer related to mechanisms of evolution.
Evolution Review: Study Guide completion and review game.
Goal: apply the concept of evolution and natural selection.
Vocabulary: Bottleneck, Founder Effect, Genetic Drift
Look at examples.
Youtube: human evolution made easy, theory of evolution made easy.

Working on study guide, pyramid, simpsons clip.

Goal: Summarize evidence for evolution using a powerpoint presentation
1.) Evolution of their favorite animal ppt.
2.) Review Questions based on Standards, Pyramid, Millionaire.

Cell Parts into Natural Selection

2010-08-19T17:59:00.001-07:00

Monday 8/23
SWBAT connect functions of cell parts to functions of a variety of objects.
-Finish cell parts vocabulary
-Cell as school, three columns (School Part, Function, Cell Part)
1.) NOTES: Students are given 17 different objects, they then must connect the function of those objects to the functions of a specific organelle.
2.) Game: Cell Parts pyramid.
3.) Cell Parts quiz with analogies.
4.) Cell Parts millionaire.

Tuesday 8/24
SWBAT act out the function of the plasma membrane. Describe structure and function of the plasma membrane. (Active, Passive Transport, Osmosis, Diffusion)
1.) Cell Part Quiz-Analogies
2.) Cell Membrane Role Play (Membrane bilayer, transport protein, sugar, salt sodium and chlorine, water),
3.) Cell Membrane structure and function ppt.
4.) Computer simulations for cell membrane.
5.) Vocabulary Discussion: diffusion, osmosis, active transport, passive transport.
Notes: Cell membrane map.

Wednesday: Cell Role Play and Cell Part Analogies (17 objects: potato, cup, bag, filter paper, gum drops, baby formula, blueberry box, owl pellet, beans, scissors)

Thursday
SWBAT: Describe the structure and function of the cell membrane.
1.) Hyper, Hypo, Isotonic Vocabulary. (Afternoon Class: Around the room cell part labeling: Quiz for afternoon class)
2.) Role Play with cell parts and cards.
3.) Overall cell membrane picture and images on Utah's website.
4.) Parts of the cell membrane vocab (selectively permeable, phospholipid, membrane protein, transport proteins, steroid, glycoprotein)
5.) Functions of the cell membrane vocab (Active, Passive Transport, Diffusion, Osmosis, Endocytosis, Exocytosis)
6.) Cell Part Match Game.
7.) Reflection:
What have you learned this year about the cell you didn't know before?
What was the most helpful activity in learning about the cell that we have done so far, why was that most effective?
Is there anything you are confused about so far?
What do you think is the most important problem facing the community you live in? Explain.

Friday 8/27
SWBAT: Describe the structure and function of the cell membrane.
Men in Tights Video, Redo Role Play, Have students draw a picture in their notes section of the cell membrane role play, Vocabulary Discussion, missed from Friday
Stations of models cells, different solutions of salt and water with model cells.

FOR LATER THIS YEAR
1.) Graphic Organizer with Active, Passive, Endocytosis, Exocytosis, Diffusion, Osmosis.
2.) Cell Membrane ppt. and Youtube Playlist of cell membrane functions as review of cell membrane.
3.) Interactives about the cell membrane from Teacher's Domain.
4.) Cell membrane picture with parts labeled and analogy for its function.

Monday 8/30: How did all the different forms of life get here? SWBAT: describe the process of Natural Selection. (B.1.31)
1.) Start Natural Selection with toothpicks lab and data analysis.

Tuesday 8/31: SWBAT: Construct a device that carries a bean at least 2 meters (B.1.31), and describe the process of natural selection.
1.) Natural Selection Story and Notes
2.) Bean Testing.

Wednesday: 9/1 (B.1.31)
1.) "The Chips are Down" Pieces of paper natural selection hands on simultation and graphing.

Thursday (B.1.31)-Finish chips are down lab.
1.) Natural Selection Computer Simulations. Nowhere to hide, Evolution Lab, Natural Selection Peppered Moths
2.) Students use a grid in their notebooks to analyze the computer situations where natural selection is occuring.
3.) MRSA Video

Friday: (B.1.31)
1.) Vocabulary: Species, gene, gene pool, mutation, Competition, Speciation, Natural Selection
2.) Bean Device Testing again.
3.) Natural Selection vs. Selective Breeding moving around the room.
4.) Vocab: Asexual, sexual reproduction, inherited vs. acquired traits.
5.) Pyramid with Natural Selection

Tuesday: 9/7 (B.1.31)
1.) Dog Card game, answer questions, and graph your results against someone from another group.

Wednesday: 9/8
1.) Fossil Evidence Activity in Notebook under labs/observations.
2.) Fossilization Process-Notes.
3.) Write a book about how a friend of yours became a fossil. 4 pages.

Thursday: 9/9
Goal: Recognize and explore trends in the Fossil Record.
Reflection: Engage "I would like to die next to a river and drown so that I could become a fossil" Agree or Disagree. Why?
1.) Pass back papers, final bean testing.
2.) Story About a friend being fossilized.
3.) Rules of science as a game.
4.) Creationism, Darwin, Lamarck Notes: Darwin vs. Lamarck Classification of statements.
5.) Scientific Method youtube video.

Friday 9/10
Goal: Describe four attributes of a scientific theory.
Finish Earth Timeline.
Mystery container picture drawing. Rules of Science

Friday 9/10
1.) "A theory is more valid than a hypothesis because it is based on evidence"
2.) Notes: Attributes of a theory details.
-Based on evidence
-Explains situations
-Falsifiable
-Makes predictions
3.) Chart comparing Creationism, Evolution.
4.) Creationism, Darwinism, Lamarckism Notes
5.) Darwin vs. Lamarck around the room.
6.) Earth Timeline. History of earth youtube video.
7.) Reading and notes on Darwin's theory. (pg. 393-396)
8.) Natural Selection and History of Life on Earth Test on Friday.

Monday 9/13
Goal: Students describe four types of evidence for evolution
VOCABULARY:(Homologs, Analogs, Vestigial, Adaptive Radiation, DNA Similarities, Falsifiability)
1.) Review theory attributes.
4.) Around the room classification.
4.) Exit half sheet, "What is the most convincing piece of evidence for you? Why?"
5.) Homework: Reading evolution section 1 in the textbook.
6.) Pyramid

Tuesday: 9/14
Goal: describe the different mechanisms of evolution.
-Review the 4 parts of Natural Selection, 4 attributes of a scientific theory.
1.) Read and notes pg. 407-413.
2.) Complete Graphic Organizer related to mechanisms of evolution.
Evolution Review: Study Guide completion and review game.
Goal: apply the concept of evolution and natural selection.
Vocabulary: Bottleneck, Founder Effect, Genetic Drift
Look at examples.
Youtube: human evolution made easy, theory of evolution made easy.

Wednesday: 9/15
Dog evolution video with questions.

Thursday: 9/16
Working on study guide, pyramid, simpsons clip.

Friday 9/17
Goal: Summarize evidence for evolution using a powerpoint presentation
1.) Evolution of their favorite animal ppt.
2.) Review Questions based on Standards, Pyramid, Millionaire.

Monday: 9/20
Test, Money as energy demonstration.
Oh Deer Game and Graphing.

Tuesday: 9/21
1.) Money as energy demonstration again.
2.) Vocabulary Development for Ecology: Limiting Factor, Heterotroph, Autotroph, Decomposer, 2nd law of thermodynamics.

Wednesday: 9/22
Outside walk vocabulary chart. (collection of a variety of leaves) for classification.

Thursday: 9/23
Ecology Gizmo.

Monday: 9/28
Great Lakes Invasive Species Book

Tuesday: 9/29
Succession ppt. and notes, Succession walk.

Tuesday: 9/30 Dunes interconnectedness activity.

Wednesday: 10/1
Succession Field Trip.

Thursday: 10/2
Succession Field Trip Picture Description

Left Overs:
Great Lakes Invasive Species

Start Prokaryotic vs. Eukaryotic Explore lab with picture and description of each where students determine the differences between the two types of cells.

APE Genius

Classification of leaves.

Start of 2010

2010-08-10T09:00:00.000-07:00

Monday: 8/16
-Working on filling out a notecard (information). (First and Last Name, phone numbers, favorite science activity, one question for me, on back what is your lifetime ambition)
-Expectations powerpoint.

-Asians, Asian Americans, and Americans: Reading and Answering Questions. Discuss writing utensil procedure. Working on discussion procedure.
-Why I teach Biology. (human health, we all take care of others, understanding the universe)
-Assignment: Get a composition notebook by Wednesday (Put name on it keep it in class, see summer school for divisions).
-Cell Parts and functions analogy handout.
-Review Scientific Method: Make a hypothesis, perform experiment, gather data, analyze data, conclusion, further questions.
Plop it with birthdays and ask why these months? Where were you born? Is there a connection between where you were born and when you were born?

Tuesday (Computer Lab): Goal determine perceptions of student learning. 8/17
Cell Analogies Handout
Go over computer lab rules (no food or drink, no games, educational purposes only, no proxies)
1.) Beginning of school survey.
2.) Create an email address that is appropriate for professional purposes. gmail.
3.) Sign up for Freshman Biology on edmodo.com
-Go to edmodo.com
-Insert the code equ292 as our class code.
-Under settings, sign up for notifications as Text Message. (put in your #)
4.) Modalities Worksheet and Grid of different types of learners put name and type of learner on a popsicle stick for drawing names out of a hat and determining groups.
5.) Done? Explore Nobel Prize Cell Parts Game, Malaria Game.

Wednesday: 8/18
Goal: SWBAT determine what happens in the brain when they learn something new.
-Review cell analogies, cell parts and functions.
-Go over turning in work procedure.
-Is it Alive Formative Assessment Probe
-Mindset article reading and discussion.
-How your brain works powerpoint use looseleaf paper

Thursday: 8/19
SWBAT observe the behavior of cells in different salt solutions, set up notebooks.
Monday of second week: (using lab notebook)
Set up notebooks:
Notebook Guidelines: I'll tell you what to put into your notebook and when. You can add biological observations at any time.
Page One: Table of Contents:
First: 25 Pages (2-26) of Observations/Labs,
Second: 30 Pages of Vocabulary (27-57),
Third: 24 Pages of Notes (58-80),
Fourth: 20 pages of Reflections. (80-100)
1.) Potatoes in different types of water. Discuss controls and variables.
-Formative Assessment Probe: Basic form of life and is it made of cells.
2.) Potatoes in different locations throughout the room. Four Columns: Liquid mixture #, potatoes in observation, how much salt do you think, explanation. 1 all water, 17 lots of salt. 3-17 variable amounts of salt.
3.) In your observations/lab section of your notebook, list the order you think the cups are from least salty to most salty and why.

Friday: 8/20
SWBAT: describe the functions of a variety of cell parts.
Pyramid Powerpoint
1.) Inductive reasoning with different things and marking an x next to the things made of cells.
2.) Formative assessment probe: Is it made of cells?
3.) NOTES: Start with parts of a school determine function, and then list the cell part.
4.) VOCABULARY: Cell Parts vocabulary discussion (Cell Membrane, Ribosome, Nucleus, Chloroplast, Cell Wall, Mitochondria, Endoplasmic Reticulum, Cytoplasm, Chromosomes/DNA, all on the chart)
5.) Activity Cell Parts labeling parts of the room with post notes. (Next day, have the large signs on each object)
6.) Vocabulary and Notes: Hypotonic, Isotonic, Hypertonic Solutions Notes and then vocabulary
-Cell Parts random objects analogies.
-Cell Parts pyramid.

Monday 8/23
SWBAT connect functions of cell parts to functions of a variety of objects.
1.) NOTES: Students are given 17 different objects, they then must connect the function of those objects to the functions of a specific organelle.
2.) Game: Cell Parts pyramid.
3.) Cell Parts quiz with analogies.
4.) Cell Parts millionaire.

Tuesday 8/24
SWBAT act out the function of the plasma membrane. Describe structure and function of the plasma membrane. (Active, Passive Transport, Osmosis, Diffusion)
1.) Cell Part Quiz-Analogies
2.) Cell Membrane Role Play (Membrane bilayer, transport protein, sugar, salt sodium and chlorine, water),
3.) Cell Membrane structure and function ppt.
4.) Computer simulations for cell membrane.
5.) Vocabulary Discussion: diffusion, osmosis, active transport, passive transport.
Notes: Cell membrane map.

Wednesday 8/25
-Test over cell parts and functions. (emphasis on the cell membrane)
-Unknown tin can activity

Start of 2010-2011

2010-07-23T09:46:00.000-07:00

Monday:
-Working on filling out a notecard (information). (First and Last Name, phone numbers, favorite science activity, one question for me, on back what is your lifetime ambition)
-Expectations powerpoint.
-Asians, Asian Americans, Americans, Reading and Answering Questions. Discuss writing utensil procedure. Working on discussion procedure.
-Why I teach Biology. (human health, we all take care of others, understanding the universe)
-Assignment: Get a composition notebook by Wednesday (Put name on it keep it in class, see summer school for divisions).
-Cell Parts and functions analogy handout.
-Review Scientific Method: Make a hypothesis, perform experiment, gather data, analyze data, conclusion, further questions.
Plop it with birthdays and ask why these months? Where were you born? Is there a connection between where you were born and when you were born?

Tuesday (Computer Lab): Goal determine perceptions of student learning.
Cell Analogies Handout
Go over computer lab rules (no food or drink, no games, educational purposes only, no proxies)
1.) Beginning of school survey.
2.) Create an email address that is appropriate for professional purposes. gmail or yahoo.
3.) Sign up for Freshman Biology on edmodo.com
-Go to edmodo.com
-Insert the code equ292 as our class code.
-Under settings, sign up for notifications as Text Message. (put in your #)
4.) Modalities Worksheet and Grid of different types of learners put name and type of learner on a popsicle stick for drawing names out of a hat and determining groups.
5.) Done? Explore Nobel Prize Cell Parts Game, Malaria Game.

Wednesday
Goal: SWBAT determine what happens in the brain when they learn something new.
-Review cell analogies, cell parts and functions.
-Mindset article reading and discussion.
-How your brain works powerpoint. use looseleaf paper

Thursday
SWBAT observe the behavior of cells in different salt solutions, set up notebooks.
Monday of second week: (using lab notebook)
Set up notebooks:
Notebook Guidelines: I'll tell you what to put into your notebook and when. You can add biological observations at any time.
Page One: Table of Contents:
First: 25 Pages (2-26) of Observations/Labs,
Second: 30 Pages of Vocabulary (27-57),
Third: 24 Pages of Notes (58-80),
Fourth: 20 pages of Reflections. (80-100)
1.) Potatoes in different types of water. Discuss controls and variables.
-Formative Assessment Probe: Basic form of life and is it made of cells.
2.) Potatoes in different locations throughout the room. Four Columns: Liquid mixture #, potatoes in observation, how much salt do you think, explanation. 1 all water, 17 lots of salt. 3-17 variable amounts of salt.
3.) In your observations/lab section of your notebook, list the order you think the cups are from least salty to most salty and why.

Friday:
SWBAT: describe the functions of a variety of cell parts.
1.) Inductive reasoning with different things and marking an x next to the things made of cells.
2.) Formative assessment probe: Is it made of cells?
3.) NOTES: Start with parts of a school determine function, and then list the cell part.
4.) VOCABULARY: Cell Parts vocabulary discussion (Cell Membrane, Ribosome, Nucleus, Chloroplast, Cell Wall, Mitochondria, Endoplasmic Reticulum, Cytoplasm, Chromosomes/DNA, all on the chart)
5.) Activity Cell Parts labeling parts of the room with post notes. (Next day, have the large signs on each object)
6.) Vocabulary and Notes: Hypotonic, Isotonic, Hypertonic Solutions Notes and then vocabulary
-Cell Parts random objects analogies.
-Cell Parts pyramid.

Monday
SWBAT connect functions of cell parts to functions of a variety of objects.
1.) NOTES: Students are given 17 different objects, they then must connect the function of those objects to the functions of a specific organelle.
2.) Game: Cell Parts pyramid.
3.) Cell Parts quiz with analogies.
4.) Cell Parts millionaire.

Tuesday
SWBAT act out the function of the plasma membrane. Describe structure and function of the plasma membrane. (Active, Passive Transport, Osmosis, Diffusion)
1.) Cell Part Quiz-Analogies
2.) Cell Membrane Role Play (Membrane bilayer, transport protein, sugar, salt sodium and chlorine, water),
3.) Cell Membrane structure and function ppt.
4.) Computer simulations for cell membrane.
5.) Vocabulary Discussion: diffusion, osmosis, active transport, passive transport.
Notes: Cell membrane map.

Wednesday
Test over cell parts and functions. (emphasis on the cell membrane)

End of year review with making multiple choice questions.

2010-05-20T09:45:00.001-07:00

Step One:
-Go to surveymonkey.com create a free account with your partner.

Step Two:
-Make a ten question survey
-Can be multiple choice, free response, true or false of varying difficulty.
3-Easy, 3-Medium, 3-Difficult
-Can have one random, subjective question.

Step Three:
-Post the link of your survey as a comment to this blog, with your names on the comment.

Step Four:
-Take other people's surveys as a practice for the exam.

Step Five:
-Analyze the results of your survey after people have taken yours.

U-Pick Fruit Guide

2010-05-20T06:16:00.000-07:00

Xtranormal Video Links

2010-05-12T04:58:00.001-07:00

Loading...

Comment to this post with your name and the link to your video.

May 3-May 8

2010-05-01T18:03:00.000-07:00

Loading...
Monday:
Child's questions situations finish.
Show extranormal website.
Biological Misconceptions Agree or Disagree-Start writing dialogue between two individuals.
Mitosis vs. Meiosis Review

Tuesday:
Practice ECA Test

Wednesday:
Tree Growth Sketch (5-6 per group)
Making Measurements in groups

Thursday:
Biological Control Lesson Plan using Botany of Desire

Friday:
Start Biological Misconception Extranormal Scenario.

Monday: Frog NOVA

Tuesday: Frog NOVA

Wednesday: Frog Collection.

Cell Membrane Structure and Function, Patented Genes

2010-04-04T03:21:00.000-07:00

Monday:
1.) Finish Food Inc.
2.) Discussion.
3.) Patented Genes Discussion. 60 Minutes Clip.

Tuesday:
Patented Genes Trial.
9 Trial, 1 Judge, 1 Bailiff, 2 Defendants of the Company, 2 Plaintiffs (2 sisters), Rest are Lawyers.

Wednesday: Court Drama

Thursday: Finish Court: Review Mitosis vs. Meiosis, Structure and Function of Blossom Parts

Friday:
Connect Structure and Function to Cell Membrane and Mouse Party Utah Genetics.

Monday:
Cell Membrane vocabulary and notes (Review: Active, Passive, Diffusion, Facilitated Diffusion, Endocytosis, Exocytosis)
Cells in solutions lab.

Tuesday:
DNA Extraction Lab:
Cell Membrane Quick Quiz
Start Skits about what a child might ask you.

Weeks before and after Spring Break, Essay Test, Food Inc.

2010-03-21T09:00:00.000-07:00

Monday
1.) Orchard Vocabulary: Scion, Rootstock, Variety, Resistant, Sterile
Give students
Apple Varieties we are planting:
Honeycrisp
Nova Spy
Nova Mac
Pink Lady
Royal Empire
Type X of Pear
For each variety students will determine...
-Fruit characteristics (flavor, color, size, use, picture)
-What pollenates this tree? Give a list so we know what to plant near it.
-How was this apple developed? Where? Is it a hybrid between other types of apples?
-Time of Ripening
-Special care that is needed.
-Resistance/susceptibility to different diseases.
-Years to fruiting.
Provide a source for your information.

Tuesday
Sub-Food Incorporate Video watching and answering questions.

Wednesday
1.) Finish Food Incorporated.
2.) Working on outline of boardgames.
3.) (4th Hour, plant trees, at least dig holes) Walk to orchard to see where each will be planted?

Thursday
Homeostasis competition. Reminder of Essay Test after spring break, starting on Wednesday.

After Spring Break
Monday:
Essay Review
1.) DNA to Protein. Transcription and Translation.
2.) Natural Selection and Evolution
3.) HPV Infection
4.) Prokaryotic vs. Eukaryotic Cells
5.) Mitosis vs. Meiosis
6.) Succession.
7.) Gardasil Vaccine Starting at 2:30 min.

Finish Game boards, Computer Lab Printing of Directions, Making of Pieces.

Tuesday: Play games? Study for test.

Wednesday: Essay Test.

Thursday: Start Food Incorporated Video.

Friday: B day for Test. Play games. Watch Video.

Monday: Socratic Discussion of Video.

Metabolism 2010

2010-03-16T17:27:00.001-07:00

Monday
Goal: Describe Metabolism, Glycolysis, Krebs Cycle, Electron Transport, ATP, and Energy Production.
1.) Create List of ways we use energy.
2.) Create list of ways we obtain energy.
3.) Describe sucrose and fructose as 6 carbon sugars that are converted in energy through respiration. (Direct notes)
4.) ppt. discussion

Tuesday
Goal: Describe the process of respiration and sugar breakdown.
1.) Making chose your own adventure book of how glucose gets broken down into carbon dioxide. (Glycolysis, Krebs, Fermentation)
2.) Test Corrections.

Wednesday
Goal: Analyze features of different sugar substitutes and their effects on humans.
1.) Introduce sugar substitutes.
2.) Online Metabolism Survey.
3.) Computer Lab Sugar substitutes research and ppt. completion.
4.) Possible Sugar Substitutes: Sucralose, Splenda, Aspartame, Dulcin, Cyclamate, Saccharin, Neotame, Acesulfame-K, and Lead Acetate.
Helpful Links
FDA Approved Sweeteners
Elmhurst College Artificial Sweeteners Site.

Wikipedia Sugar Substitutes Comprehensive Listing and Discussion of Major Artificial Sweeteners.
Cancer and Artificial Sweeteners (Cancer.gov)
How stuff works: Artificial Sweeteners
Coca-Cola Information on Artificial Sweeteners

Thursday: Catch Up, Review Cards.

Friday
Goal: Analyze features of different sugar substitutes and their effects on humans.
1.) Finish Sugar Substitute Research ppt.
2.) Cell Parts Basketball.
3.) Respiration Basketball.
4.) Heterotrophic vs. Autotrophic basketball. Hint: CO2 is inorganic while sugar is organic.

Monday
Goal: Students explain sugar breakdown steps and metabolism test.
1.) Reading each other's books.
2.) Carbon Cycle Game. (with Core 40 Cards)
3.) Quiz tomorrow.

Slime, Boardgames, Protein, Macromolecule Review

2010-03-10T17:47:00.000-08:00

Monday:
1.) Slime audio first section.
2.) Start going over board game-Need to work out rules by Wednesday.
3.) Write down all of the food you ate on Sunday

Tuesday: predict the food product based on the nutrition label but not the ingredients.
Botulism and jobs-apprentice.blogspot investigation.
1.) Notes on Protein Structure and Function. *Use from online ppt.
2.) Be sure to include the functions of proteins within the cell.
3.) Quadrafold Structure of Proteins and a Quadrafold Function of Protein four way foldable for homework.

Wednesday:
SWBAT: Describe ways to protect proteins.
1.) Why does acid smell bad? Why does rotten food not look good? Discussion of evolution of senses to protect humans.
2.) Egg white observations.
3.) Protect your proteins Public Service Announcement.

Thursdaysday:
Determine the amount of grams of the 3 major macromolecules you ate.
Practice Multiple Choice Questions
1.) Go to Body Mass Index calculator on line.
2.) Nutrition Facts.com Look up the foods you ate and determine the number of grams of protein, carbohydrates, and fats you ingested yesterday.
3.) Complete the half sheet. Percent Above/below is equal to the difference between the recommended and actual amounts divided by the recommended amounts*100.
4.) Succession review game.
5.) RNA and Protein Synthesis Game.

Friday:
Sex and the SETI First Section.
1.) Review structure and function of proteins.
2.) Have labels throughout the room, students record the data and try to determine the food from the clues. Giving a rationale for their decision.
3.) Protein Structure and Function Quiz.

Classification and Connection to Evolution

2010-03-05T10:36:00.000-08:00

Friday: Marketplace: Entrepreneurship gene.
1.) Shoe classification engage exploration.
2.) Organism starting classification.

Monday:
1.) 5 Kingdom Explanation.
2.) 5 Kingdom placement of organisms
3.) 5 Kingdom Video

Tuesday:
1.) Monera Habitat Adaptation matching with astro-biology connection game.
2.) 2nd deck speed racing.

Wednesday:
1.) Computer Lab-Investigating the slides that will be done on Thursday and Friday.

Thursday and Friday:
Microscopes to investigate a the variety of life.

Learned vs. Innate Behavior

2010-02-18T16:17:00.000-08:00

Monday:
Goal: determine reaction time and relate it to Natural Selection.
1.) Discuss test on Tuesday: Stem Cells, Field Trip, Parkinsons.
2.) Review Cards
3.)What do you think causes differences in reaction time between individuals? What question would you ask people?
4.) Reaction Time calculations Students complete their reaction time 10 times and determine the average.
5.) List from fastest to slowest. (determine mode, median, mean with and without outliers)

Tuesday:
1.) Nerve Cells Review
2.) Review Cards
3.) Computer Reaction Time Testing
4.) Questionairre Completion.

Wednesday:
Test:
1.) Deck #2 of review Cards.

Thursday:
1.) Behavior vocabulary: Learned, Innate.
2.) Training a Dog with Pavlov.
3.) Graphing Reaction Time vs. other variables.

Friday
1.) Review Deck #2
2.) Stimulus Response Vocabulary, Online Trained Dog, Pavlov's Dog online.
3.) Classifying organisms

Monday
1.) Graphing Reaction Times

Tuesday
What sets us apart from APE's
APE Genius Video and Questions

Wednesday
Finish APE Genius

Thursday
Introduce Essay Test Questions, Board Game

Friday
Introduction to classification.

Monday: Going into classification...
Dichotomous Key with Shoes, etc.

Stem Cells

2010-02-12T16:10:00.000-08:00

Monday:
1.) Antibiotics in Farm Animals survey.
2.) Antibiotics in farm animals chart.
2.) Antibiotics Video Clips.
3.) You are in the Indiana State Senate. A bill has been proposed to make it illegal to use antibiotics in healthy farm animals. The bill would establish an oversight organization to enforce this new law and would cost $2 million to operate annually. Would you vote for this bill?

Tuesdsay:
1.) Finish Powerpoints.
2.) Stem Cell Guy

Wednesday: Stem Cell video

Thursday: Stem Cell Video

Friday: Stem Cell Discussion/vote.
Stem Cell Research PBS Online video. Stem Cell Scenario. What should be done with extra embryos that a couple does not want to implant. The embryos have been frozen for seven years. The oldest child is a girl who is 7 (IVF child), the middle child is a 4 year old boy (IVF child), the youngest is a 4 month old girl (conceived naturally). In the first two pregancies, two to three eggs were implanted each time but only 1 embryo survived to birth.
-Possibilities
-Implant the embryos, sell them on the black market, donate them to research, other.

Leading into Chicago...then Stem Cells

2010-01-21T04:46:00.000-08:00

Monday:
SWBAT: describe the endosymbiant theory.
Yarn to demonstrate the endosymbiant theory.
-cyanobacteria are single-celled bacteria that do photosynthesis.
Vocab: Cyanobacteria, prokaryotes, eukaryotes, endosymbiosis.
Endosymbiant videos.

Tuesday:
SWBAT: make and present endosymbiosis presentation.
1.) Poster: 3 images and details of endosymbiosis. (pair)
2.) Skit: 1 minute skit acting out the details of endosymbiosis. (group of three at most)
3.) Cartoon/Comic: At least 5 boxes describing the process of endosymbiosis in an entertaining fashion. (Pair)
4.) Song Lyrics: At least a 30 second song showing the details and importance of endosymbiosis. (Pairs or alone)
5.) Ten line poem (alone)

Wednesday:
SWBAT: self evaluate their understanding of biology state standards.
1.) reading of standards with self rating and determining words that they know and don't know.

Thursday:
Explore Field, Shedd, and Planetarium online exploration.

Friday: Determine what is expected at Museums. Going over trip map and pictures.

Thursday or Friday: Field Trip. Pictures.
Five Paragraph essay summarizing field trip.
Be sure details include:
What relates to biology class.
Favorite parts of each location.
Final Paragraph: Conclusion, ways to improve, worth $20?, Day out of school?

Thursday or Friday: Putting pictures into a slideshow with your group on powerpoint.
email the pictures to jogensic@npusc.k12.in.us

Monday: Going over pictures. Stem Cell Vocabulary (biogensis)

Tuesday: Stem Cell Guy

Wednesday+Thursday: Stem Cell Research PBS Online video. Stem Cell Scenario. What should be done with extra embryos that a couple does not want to implant. The embryos have been frozen for seven years. The oldest child is a girl who is 7 (IVF child), the middle child is a 4 year old boy (IVF child), the youngest is a 4 month old girl (conceived naturally). In the first two pregancies, two to three eggs were implanted each time but only 1 embryo survived to birth.
-Possibilities
-Implant the embryos, sell them on the black market, donate them to research, other.

Friday: Sides of the room, Strongly Agree, Agree, Disagree, Strongly Disagree to these series of statements.
1.) Using embryo
Friday: Essay Test Questions sent out, studying.

Genetics, Meiosis, Mendel

2009-12-18T07:34:00.000-08:00

Wednesday:
Go over Final Exam, Item by Item
Finish Osmosis Jones?

Thursday: Goal: Connect experimental results to genetic explanations.
Mendel Experiments Story Telling about mating.
1.) Mouse Gizmo Experiments
-Describe Parents, hypothesis, results, and conclusion.
2.) Genetics Exploration with Mice and Test experiments.

Monday: Goal: Use appropriate terminology to describe genetic inheritance.
1.) Review: Homologous Chromosomes in Somatic Cells, genes on chromosomes.
2.) Vocabulary: Genotype, Phenotype, Allele, Gene, Gene Activation, Gene Suppression, Dominant, Recessive, Heterozygous, hybrid, carrier, Homozygous, pure breed, F1, F2, Youtube Genetics Playlist.
3.) Utah "Observable Traits" Slideshow applying traits information. Create a Table of trait, phenotypes, me, mom, dad, brothers, sisters.
-9 Traits.
Observable Traits Chart for this activity. http://www.sonic.net/~nbs/projects/bio115l/form.html

Tuesday
Meiosis with paper chromosomes and Punnet Square problems.

Wednesday: Goal: Connect experimental results to genetic explanations.
1.) Vocabulary Review
2.) Punnet Square Teaching how to use (Show with a cross between BB and bb, then between Bb and Bb)
3.) Chicken Gizmo Experiments.
-Describe parents, hypothesis, results, and conclusion, write a punnett square to describe 2 situations and compare the punnett square with the
4.) Share results.

Thursday: Goal: Describe Mendel's experiments, describe the process of meiosis.
1.) Mendels's Experiments interactive http://www2.edc.org/weblabs/Mendel/mendel.html
2.) Doing Punnett Squares around the room.

Friday:
1.) Punnet Square Practice Spongebob.
2.) Youtube Genetics Playlist on jgensic's channel.

Monday:
-Nicotine Addiction Pedigress.

Tuesday:
-Microscopes examining different objects (including onion root tips with mitosis)

Wednesday:
-Meiosis with your own chromosomes and combination of gametes.

Thursday: Snow Day

Friday:
-Explore Next Generation

Monday and Tuesday:
Notes on Mendel:
Start with experiment: TT crossed with tt, then cross Tt with Tt.
Austrian Monk, July 20, 1822 – January 6, 1884
1865 and 1866 which was "re-discovered" in 1900
29,000 pea plants tested.
Law of Segregation and Law of Independent Assortment as vocabulary.
Work into dihybrid crosses until bell.

Tuesday: Vocabulary Review, Another Dihybrid Cross.
Test Tomorrow:
Test Concepts: Genetics, Meiosis vs. Mitosis, Gametes vs. Somatic, Mendel.

Wednesday: Substitute: Test.

Thursday? Egg Donation.
Mendel: Mendel meets Watson and Crick skits.
-Mendel Notes: You tube videos.
-Law of Segregation and Independent assortments.
Xtranormal: Mendel meets Darwin.
Key points:
-They never actually met.
-Darwin: came up with Natural Selection
-Mendel: came up with rules of inheritance
-Darwin's natural selection said that favorable traits were passed on.
-Mendel discovered how these traits are passed on.
-Mendel monk, Darwin English Naturalist.
-Mendel kept very detailed records

Friday:
Karyotyping, Sexual Chromosomes disorders.

Monday:
Going into history of life on earth.

Leading to Christmas, DNA Mutations, HPV and Gardasil

2009-11-24T03:24:00.000-08:00

BIO A Survey
BIO B Survey
BIO C Survey
BIO Gold 4 Survey

Family Feud Survey

Monday: Goal: describe protein synthesis and the cell cycle.
1.) Use models to practice transcription, translation, cell cycle and DNA replication.
2.) Around the room review of key terms.

Tuesday: Goal: connect protein sequences and the process of transcription and translation to evolution.
1.) Evolution and protein sequence lab.

Wednesday: Goal: describe how HPV virus causes cervical cancer and how the Gardasil Vaccine prevents cervical cancer.
1.) Video, Notes, Discussion.
2.) Reading of Gardasil for and against.

Thursday: Continue with Gardasil. Prepping for debate.
Debate: You are a parent with a daughter who is 12 years old. You are married. The state of Texas has just sent home information regarding the Gardasil Vaccine. You make enough money to cover the cost of the vaccine, but just barely. On the day of the debate you will be given the side to argue. Your daughter has not had biology yet, so she really doesn't know about it enough to make an informed decision. For today, you must investigate both sides so that you will be able to argue accordingly. Come up with as many pros and cons along with the sources of that information.

Friday: Continue with Gardasil. Debate research.

Monday: Substitute, video.

Tuesday: Gardasil Debate round one. (from homepage.montana.edu)
Debate Parts:
Analyzing Arguments:
1.) Number your boxes.
2.) On a looseleaf paper, write your name at the top.
3.) You are going to trade your arguments with others. Other people are going to determine your 2 worst boxes and describe ways for them to be improved.
Suggestions for improvement may be...
-Better Source
-Make it more logical
-More Current information
You then pick out the 2 best boxes and describe why they are the most convincing
Suggestions may be...
-very logical
-very current information
-very reputable source

-Each side makes a 4-5 minute presentation establishing a position
1. Students must clearly describe and articulate the issue.
2. Provide appropriate background information (historical, geographical).
3. Explain and Address the underlying scientific principles.
4. Defend a position (with cited evidence) about the best way for the family to respond to the issue.

-Each side then has 3 minutes for a rebuttal 1. Address the points raised by the opposing side.
-The remaining class time is open for general questions from the "6th grader"

Wednesday: Gardasil Debate round two. How gardasil works and HPV works quiz. Same as before just rotated positions.

Thursday: Food Incorporated Video. Starting to review concepts for final exam.

Friday: Finish Food Incorporated Video.

Monday: Rudolf Lab, Finals review

Tuesday: Fishing Lab, Finals review

Wednesday: Cell Cycle Review, Evolution of Dance, Family Feud, Finals Studying

Thursday: Final

Friday: Make-up Final: Go over the final.

Mutations, DNA, Protein Finish

2009-11-20T10:12:00.000-08:00

Monday: Students distinguish between types of mutations.
DNA to Protein Review
1.) Mutations on Molecular Workbench in front of class
2.) Mutation notes
3.) Students work on Mutations on their own in computer lab.

Tuesday: Students describe how mutations impact proteins.
DNA to Protein Review
1.) NOVA Science Now: Science of Picky Eaters.
2.) Students present their individual mutation ppt. to each other, while others record the chromosome and protein impacted.

Wednesday: Students related mutations to how DNA controls the cell.
1.) Test, read and discuss mammography changes article.

Happy Turkey Day

Monday: Students review cell cycle and DNA to Protein
1.) Cell Cycle with partner and paper chromosomes.
2.) Around the room with mRNA, tRNA, DNA, and protein classifications.

Tuesday: Students explore cell cycles with microscopes.
1.) Onion Root Tip Lab?

DNA to Protein, Single Gene Mutations

2009-11-10T05:07:00.000-08:00

Tay Sachs Disease:
Symptoms: relentless deterioration of mental and physical abilities occurs. The child becomes blind, deaf, and unable to swallow. Muscles begin to atrophy and paralysis sets in. Death usually occurs before the age of 4. What do you think causes this? Most common among Jewish people.

Monday:
Goal: Students describe how DNA provides template for proteins.
1.) DNA controls a cell, how?
-It uses the force to control actions.
-It provides a code that determines the structure of lipids that control reactions throughout the cell.
-It provides a code that determines the structure of proteins that control reactions throughout the cell.
-It provides a code that determines the structure of carbohydrates the control reactions throughout the cell.
FACTS:
DNA too large to get out of the nucleus. But still controls the cell. How?

2.) Transcription and Translation Videos HHMI.
3.) Translation and Transcription Notes.
Step 1: Cell gets a signal that a certain protein needs to be made.
Step 2: DNA is unwound and transcribed into a mRNA molecule. (gene activation)
Step 3: mRNA carries DNA's message to the ribosome.
Step 4: mRNA is translated at the ribosome into a protein by tRNA bringing amino acids to the ribosome.
Vocab: Transcription, Translation, mRNA, tRNA, Central Dogma,

4.) Translation and Transcription role play with DNA (ATTACGATCTGCACAAGATCCT) codes in groups. Sheet for DNA Helicase, RNA Polymerase, and then ribosome, and tRNA (one carrying methionine/aug, leucine/gac, aspartic acid/gug, valine/uuc, phenylalanine/uuc, and stop/uag.

Tuesday:
Review: Transcription and Translation.
1.) Prior Knowledge Question:
Is all of the DNA in a cell active in coding for protein?
a.) No, only certain parts of the DNA are active, this determines the type of cell.
b.) No, only certain parts of the DNA are active, this is determined by the individual.
c.) Yes, all the DNA is active, this is what makes cells different from one another.
d.) Yes, all the DNA is active, this is what makes individuals different from one another.
2.) Transcription and Translation role play review.
3.) Transcription and Translation worksheet.

Wednesday:
Review: Transcription and Translation computer interactives.
1.) Follow this series of links to work out steps to transcription and translation.
2.) Utah Genetics
3.) Teacher's Domain
4.) Explorelearning.com: Protein Synthesis Use a login and password.
5.) Another Transcription Animation
6.) Another translation animation.

Thursday:
Quiz: Transcription and Translation.
Start single gene mutation research.

Topics...
Type 1 Galactosemia
Sickle Cell Anemia
Cystic Fibrosis
Tay-Sachs
Phenylketonuria
Glycogen Storage Disease Type I
Familial hypercholesterolemia (LDL receptor) cholesterol
Huntington's Disease
Polycystic kidney disease
Hemophilia A
Lesch–Nyhan syndrome
Canavan Disease
Marfan Syndrome
Norrie Disease

Monday:
Genetic Disease Presentations?

Tuesday:
Computer Lab Mutation impacts

Wednesday:
Food Incorporated?

Cancer, Going into DNA to Protein

2009-11-04T07:04:00.000-08:00

Thursday:
Cancer Research

Friday:
Skits and Cancer Research Finish

Monday:
Cancer Scenario introduction.
Healing Cancer Video.

Tuesday:
Healing Cancer Video and reading article by American Cancer Society about the Gerson Method.
-Write 2 paragraphs.

Wednesday:
Apple Research

Thursday:
How does DNA control the rest of the cell.
Start DNA to Protein Activities.

Friday: Substitute, Test over Cell Cycle, Cancer, DNA structure and replication.

DNA Start, Replication, Cell Cycle, Cancer

2009-10-21T09:38:00.000-07:00

Monday:
Goal: Describe Structure and Function of DNA.
1.) Formative Assessment
When you examine the DNA inside a skin cell on your finger and examine the DNA in a muscle cell in your heart, what will you find?
a.) They have different DNA because they look different.
b.) They have different DNA because they do different jobs, one protects and one pumps.
c.) They have the same DNA because they are from the same individual.
d.) They have the same DNA because they are both from a human.
Socratic Discussion.
2.) Notes on Basic Development: Fertilization, Cell Division, Differentiation.
3.) Building DNA molecule models: Two strands that are complementary. Using old models. (14 sets) TACGATCTGATC (Totals of 14 T's, 14 A's, 10 C's, 10 G's) 48 total.

Tuesday
Goal: Describe the process of replication.
1.) Describe and model the process of replication of DNA.
Steps to the race:
a.) DNA helicase separates the DNA strands
b.) DNA Polymerase brings in spare nucleotides to create two strands.
c.) Practice in your pairs to go as quickly as possible.
d.) Go against one another

Wednesday
Goal: Describe the process of replication.
1.) Replication Tournament
2.) Nobel Prize DNA game.
3.) Explorelearning Replication interactive.

Thursday
Goal: Describe the cell cycle.
1.) Notes: Cell Cycle: Growth 1, Synthesis, Growth 2, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis.
2.) Cell Cycle Act out with the paper chromosomes (I describe the stages)

Friday
Goal: Describe the cell cycle.
1.) Cell Cycle Practice with chromosomes
2.) Cell Cycle Ordering on paper.

Monday
Goal: act out cell cycle.
1.) Cell cycle tournament (probably not) Cell cycle ordering, Yes.
2.) Cell cycle roll play
3.) Cell Cycle reading 8.2 and 8.3 notetaking and reflection on the back.
4.) Problems with the cell cycle?

Tuesday
1.) Cell Cycle with pieces of paper.
1.) Cell Cycle Quiz
2.) Darwin to Watson and Crick skit start.

Wednesday
C. Lab: Cell Cycle Gizmo

Thursday
Angiogenesis HHMI Clip and Colonoscopy Clip from Simpsons.
C. Lab: Cancer Type research based on family history.

Friday
Darwin and Watson and Crick Skit presentations.

Monday
Microscopes: onion root tip for Mitosis stages.

Transcription and Translation are coming (ATACGATCTGATC, ATACCGCTCCGCCGTCGACAATACCACT as one code)

Atoms, Molecules, Apple Project Start, Photosynthesis and Respiration

2009-10-05T11:08:00.001-07:00

Friday Ecology Quiz: Succession, Ecology, Laws of Thermodynamics

Monday
Goal: Describe the levels of organization from atoms to organisms.
Cookie Crumbles Preassessment.
1.) Picture cutout and description of the different levels of organization.
Vocabulary: Law of Conservation of Mass: Quick burning demonstration, Start Atoms Slidshow.

Tuesday:
1.) Atomic Slideshow, Covalent and Ionic Bonds as Vocabulary.
2.) Bonding Gizmo for display purposes.
3.) Dust in the Wind.

Wednesday Thursday
Goal: Differentiate between bio-molecules: Lipids, carbohydrates, nucleic acids, and proteins. (2 days?)
1.) Vocabulary: four types of molecules, PPT,
2.) Around the room, description and what type of molecule is it?

Friday: Apple Research Side Trip.

Monday: Law of Conservation of Matter. Photosynthesis vs. Respiration Gizmo notes, apple research on 2 types of trees and 4 nurseries.

Tuesday: Fly data and questioning. Carbon Cycle Notes, Simulation of Cycles, Photosynthesis vs. Respiration GO review. Carbon, Water or Nitrogen Cycle around the room.

Wednesday:
Rev. Law of Conservation of Matter.
1.) Copy Fly Data down from last hour class., Carbon Cycle
Story of Stuff and Law of Conservation of Matter.
I want...
I am ...
-What is planned obsolescence? perceived obsolescence?
-Story of stuff reflection: What do you think? Does this change show you view shopping? How?

Thursday: Ecology Study Guide, Carbon Cycle, Atoms, Compounds, Cycles of Elements.
Goal: Review Ecology, Cycles, Photo and Respiration, Atom, Molecule, Organelle, Cells.

Friday: Quiz on Ecology, Cycles, Atoms, Compound Groups.
Next week, how do cells turn into tissues?

Ecology

2009-09-18T10:33:00.000-07:00

Checkpoint Survey

Throughout: Falsifiability of theories, magic tricks?

Monday: SWBAT: explain the difference between prokaryotic and eukaryotic cells.
1.) Examining the differences between eukaryotic and prokaryotic cells (34 copies activity):
2.) Two vocabulary words: Eukaryotic and prokaryotic.
3.) Oh Deer Population Dynamics Lab

Tuesday:
1.) Evolution Test
2.) Energy Flow example with money.

Wednesday: SWBAT: describe key vocabulary related to ecology.
Engage: Ecology Levels Online interactive. Talk about percentages
Ecology Vocab, Energy Flow: Autotroph, Heterotroph, Decomposer, 1st Law of Thermodynamics, 2nd Law of Thermodynamics, Law of Conservation of Mass, Equilibrium, Limiting Factors.
Pyramid

Thursday:
Prairie and Forest Ecology Gizmo, completing two experiments online.

Friday:
Ecology Vocabulary Scavenger Hunt. Use a chart and a plastic bag.

Monday: 9/28
Open Ocean the Deep Video and Questions.
-Sub because Mr. Gensic in Indianapolis for a presentation.

Tuesday: 9/29
SWBAT: Describe connections in our local ecosystem.
Local Ecosystem Connection Activity.

Wednesday: 9/30
SWBAT: Describe fluctuations in predator prey populations.
Pyramid Review
Predator Prey Card Game and Graphing.

Thursday: 10/1
SWBAT: describe 5 threats to the Great Lakes Ecosystem.
Great Lakes Threats ppt.
Vocabulary: Invasive Species
Great Lakes Problems Grid: Students complete grid on web resources and Great Lakes Issues.

Friday: 10/2
SWBAT: describe the process of succession.
Succession vocabulary: Catastrophe, Pioneer Species, Intermediate Communities, Climax Communities.
Succession ppt.
Reading of West Beach Trail Guide
Succession Story Book.

Monday: 10/5
SWBAT: make connections between parts of Dune Ecosystem
Dune Ecosystems Connections Grid

Tuesday: 10/6
SWBAT: Dune online games, 10 questions, Great Lakes invader story book.
1.) Page one: Before the invader came to the area (which organisms were doing this role, or which organisms were enjoying life without problems).
2.) Page two: Describe how the invader got to this area.
3.) Page three: Describe how the invader impacted the native life.
4.) Page four: Describe human action to fight the invader.
5.) Page five: Describe the current state of the invader and the ecosystem.

Wednesday: 10/7
SWBAT: hike and observe ecosystem concepts at Indiana Dunes National Lakeshore.
Take pictures of pioneer species, intermediate communities, climax community.

Thursday: 10/8 Ecosystem
1.) Dune reflection: Brief synopsis, first time, related to class, best part of the trip, would I take my kids here when I get older? and why.
2.) Pictures uploading and send to Mr. Gensic at jogensic@npusc.k12.in.us

Friday: Ecosystem Quiz

Moving from Cells to Natural Selection

2009-08-20T18:42:00.000-07:00

Friday 8/21 SWBAT: Describe the structure and function of the cell membrane.
1.) Hyper, Hypo, Isotonic Vocabulary. (Afternoon Class: Around the room cell part labeling: Quiz for afternoon class)
2.) Role Play with cell parts and cards.
3.) Overall cell membrane picture and images on Utah's website.
4.) Parts of the cell membrane vocab (selectively permeable, phospholipid, membrane protein, transport proteins, steroid, glycoprotein)
5.) Functions of the cell membrane vocab (Active, Passive Transport, Diffusion, Osmosis, Endocytosis, Exocytosis)
6.) Cell Part Match Game.
7.) Reflection:
What have you learned this year about the cell you didn't know before?
What was the most helpful activity in learning about the cell that we have done so far, why was that most effective?
Is there anything you are confused about so far?
What do you think is the most important problem facing the community you live in? Explain.

Monday 8/24 SWBAT: Describe the structure and function of the cell membrane.
Men in Tights Video, Redo Role Play, Have students draw a picture in their notes section of the cell membrane role play, Vocabulary Discussion, missed from Friday
1.) Graphic Organizer with Active, Passive, Endocytosis, Exocytosis, Diffusion, Osmosis.
2.) Cell Membrane ppt. and Youtube Playlist of cell membrane functions as review of cell membrane.
3.) Interactives about the cell membrane from Teacher's Domain.
4.) Cell membrane picture with parts labeled and analogy for its function.

Tuesday 8/25 SWBAT: Describe the structure and function of cell parts.
1.) Video about cell parts.

Wednesday 8/26 SWBAT: describe parts and functions of cell membrane.
1.) Cell membrane pyramid and review of cells parts. Do the role play again after reviewing vocabulary.
2.) Study Guide for Cell Parts and functions covering IN state cell standards (B.1.2, B.1.3, B.1.9, B.1.10)
3.) Handing out

Thursday: Test Cell parts (B.1.2, B.1.3, B.1.9, B.1.10)
Nobel Prize Cell Parts Game.

Friday: How did all the different forms of life get here? SWBAT: describe the process of Natural Selection. (B.1.31)
1.) Start Natural Selection with paper pieces lab and data analysis.

Monday: SWBAT: Construct a device that carries a bean at least 2 meters (B.1.31), and describe the process of natural selection.
1.) Bean device testing with wind.
2.) Paper pieces and Natural with activity sheet.

Tuesday:
1.) Vocabulary: Overproduction, Variation, mutation, Competition, Speciation, Natural Selection
2.) Natural Selection Cartoon production (B.1.31). One Corner each for the above key words.
3.) Natural Selection vs. Artificial Selection around the room.

Wednesday:
1.) Bean Device Testing again.
2.) Reading about natural selection and Darwin.
3.) Pyramid with Natural Selection

Thursday: Dog evolution card game.

Friday Dog evolution video.

First Week 2009-2010 Cell Parts and Cell Membrane

2009-07-13T18:46:00.000-07:00

Wednesday:
-Working on filling out a notecard (information). (First and Last Name, phone numbers, favorite science activity, one question for me, on back what is your lifetime ambition)
-Expectations powerpoint.
-Asians, Asian Americans, Americans, Reading and Answering Questions. Discuss writing utensil procedure. Working on discussion procedure.
-Why I teach Biology. (human health, we all take care of others, understanding the universe)
-Assignment: Get a composition notebook by Monday (Put name on it keep it in class, see summer school for divisions).
-Cell Parts and functions analogy handout.
-Review Scientific Method: Make a hypothesis, perform experiment, gather data, analyze data, conclusion, further questions.
Plop it with birthdays and ask why these months? Where were you born? Is there a connection between where you were born and when you were born?

Thursday (Computer Lab): Goal determine perceptions of student learning.
Cell Analogies Handout
Go over computer lab rules (no food or drink, no games, educational purposes only, no proxies)
1.) Beginning of school survey.
2.) Create an email address that is appropriate for professional purposes. gmail or yahoo.
3.) Sign up for Freshman Biology on edmodo.com
-Go to edmodo.com
-Insert the code equ292 as our class code.
-Under settings, sign up for notifications as Text Message. (put in your #)
4.) Modalities Worksheet and Grid of different types of learners put name and type of learner on a popsicle stick for drawing names out of a hat and determining groups.
5.) Done? Explore Nobel Prize Cell Parts Game, Malaria Game.

Day Friday:
Goal: SWBAT determine what happens in the brain when they learn something new.
-Review cell analogies, cell parts and functions.
-Mindset article reading and discussion.
-How your brain works powerpoint. use looseleaf paper

Day Monday: SWBAT observe the behavior of cells in different salt solutions, set up notebooks.
Monday of second week: (using lab notebook)
Set up notebooks:
Notebook Guidelines: I'll tell you what to put into your notebook and when. You can add biological observations at any time.
Page One: Table of Contents:
First: 25 Pages (2-26) of Observations/Labs,
Second: 30 Pages of Vocabulary (27-57),
Third: 24 Pages of Notes (58-80),
Fourth: 20 pages of Reflections. (80-100)
1.) Potatoes in different types of water. Discuss controls and variables.
-Formative Assessment Probe: Basic form of life and is it made of cells.
2.) Potatoes in different locations throughout the room. Four Columns: Liquid mixture #, potatoes in observation, how much salt do you think, explanation. 1 all water, 17 lots of salt. 3-17 variable amounts of salt.
3.) In your observations/lab section of your notebook, list the order you think the cups are from least salty to most salty and why.

Tuesday:8/18 SWBAT: describe the functions of a variety of cell parts.
1.) Inductive reasoning with different things and marking an x next to the things made of cells.
2.) Formative assessment probe: Is it made of cells?
3.) NOTES: Start with parts of a school determine function, and then list the cell part.
4.) VOCABULARY: Cell Parts vocabulary discussion (Cell Membrane, Ribosome, Nucleus, Chloroplast, Cell Wall, Mitochondria, Endoplasmic Reticulum, Cytoplasm, Chromosomes/DNA, all on the chart)
5.) Activity Cell Parts labeling parts of the room with post notes. (Next day, have the large signs on each object)
6.) Vocabulary and Notes: Hypotonic, Isotonic, Hypertonic Solutions Notes and then vocabulary
-Cell Parts random objects analogies.
-Cell Parts pyramid.

Day Wednesday: SWBAT connect functions of cell parts to functions of a variety of objects.
1.) NOTES: Students are given 17 different objects, they then must connect the function of those objects to the functions of a specific organelle.
2.) Game: Cell Parts pyramid.
3.) Cell Parts quiz with analogies.
4.) Cell Parts millionaire.

Thursday: SWBAT act out the function of the plasma membrane. Describe structure and function of the plasma membrane. (Active, Passive Transport, Osmosis, Diffusion)
1.) Cell Part Quiz-Analogies
2.) Cell Membrane Role Play (Membrane bilayer, transport protein, sugar, salt sodium and chlorine, water),
3.) Cell Membrane structure and function ppt.
4.) Computer simulations for cell membrane.
5.) Vocabulary Discussion: diffusion, osmosis, active transport, passive transport.
Notes: Cell membrane map.

Test over cell parts and functions. (emphasis on the cell membrane)

2008-2009 Done!

2009-05-28T09:10:00.001-07:00

Good work this year!

CORE 40, Cells, Curious Questions

2009-05-13T16:10:00.000-07:00

End of year survey

Monday:
1st: Deck of Cards, Punnet Square Practice
2nd: Deck of Cards, Board Games
3rd: Deck of Cards, Punnet Square practice
Review Cell Parts and Function
Cell Parts and Places in the room activity. Students are given a list of cell parts and they have to place the label of those parts on different parts of the room. On the back they need to explain why they chose what they chose.

Cell Parts to place throughout the room:

DNA-store genetic information, mRNA-transports DNA's code to ribosomes, tRNA-brings Amino Acids to ribosome, Cell Wall, Cell Membrane, Nucleus-protect DNA, Ribosome, Vacuoles, Lysosomes-storage and recycling, Receptor proteins, Transport protein, Mitochondria, Chloroplasts, Vesicle-small package to hold molecules, Lipids-store energy, Nucleic Acids-store information.

Tuesday and Wednesday: CORE 40 Test

Thursday: Start Curious Question Research: Find answer to question, source for info.
What do all galaxies revolve around?
How was water created?
What happens with Mad Cow disease in people?
Why can some animals live only in salt water and some animals only live in fresh water?
Can a monkey and a dog have a baby?
Can you take chloroplasts out of plant cells and put them in human cells? What would happen?
How can a scientist see a fossilized cell?
What caused the big bang?
How do robins find worms?
Do worms have eggs?
How can two normal people have a child with down syndrome?
Could everything stop evolving?
How did the first cells form?
Why do male seahorses have the baby?
Can humans survive on raw meat alone?
Can septuplets survive?
Are Siamese twins equal to each other?
What are blood vessels made out of?
How does Gardasil work?
What is better, Tanning in a tanning bed or tanning outside?
Can plants get tumors?
If you’re tall, do you have longer intestines?
Why don’t Chinese or Japanese have that much facial hair?
Are pterodactyls considered birds?
Do cell phones effect girls as much as boys?
How would triplets form?
What are the pro’s and con’s of being vegetarian?
What are the pro’s and con’s of being vegan?
Does a female have a twin gene?
Does a male have a twin gene?

1.) 1-3 Minute Presentation
2.) Question on First Slide
3.) Two-Four slides explaining the answer (include two images)

Friday: Share Information, Presentations.

Playing Biology Board Games

2009-05-05T10:43:00.000-07:00

Mon: 5 multiple choice questions, going over CORE 40 examples,
Complete Standards based games, 15 minutes each for 3 games.

Tues: Genetics Review: Computer Lab.
DNA Structure, Mutation, and Replication
population genetics,
Punnet Square Review
Protein Synthesis
Mitosis Review
practice multiple choice questions.

Wednesday: Complete Standards based games, 15 minutes each for 3 games.

Thurs: Ecology and Evolution Review: Comp. Lab. practice multiple choice questions.
Succession
Human Impact on Environment
Energy Relationships
Darwin and Natural Selection
Evidence for Evolution

Friday: Play games, 15 minutes each for 3 games.

Frogs, Games, Patented Organisms

2009-05-01T05:04:00.000-07:00

Monday:
5 CORE 40 questions
Frog Nova video with questions.

Tuesday:
5 CORE 40 questions
Finish Frog Nova video
Frog NOVA poster (Why frogs are important, what you should do, Interesting Facts)

Wednesday:
5 CORE 40 questions
Paramecium Homeostasis
CORE 40 cards

Thursday and Friday:
Making a biology review board game.

Guidelines for games:
Assign standards for each group of 4 students.

Requirement 1
Each game must include at least 30 spaces.

Requirement 2
Each game must include 20 "easy" questions related to the standard
Each game must include 10 "medium" questions related to the standard
Each game must include 8 "hard" questions related to the standard
There needs to be an answers on the cards at the bottom. If the questions are on the board, there needs to be an answer key that the "Master Biologist/Game Judge" uses.

*Options: Questions can be on the game board, as cards, a combination of both.

Requirement 3
The Game board needs to be done in pencil first, then in marker after it gets approval.

The Game board must have color decoration that relates to the standards to be covered.

Requirement 4
There needs to be at least 5 player pieces for the game board that are related to the standards covered. (Be creative)

*Options: You can set up the board as...
1.) First to finish (Like Candyland)
2.) Earning the most points until the time is up (going around a circle collecting points)
3.) Other

Requirement 5
In order to market the game, you need to create a jingle used to advertise your game. At least four lines of rhyming verse.

Reminder
We don't have dice, we do have coins.

Monday-Wednesday Playing each others games (two per period)

Thursday:
5 CORE 40 questions
Patented Organisms: Reading, questions answered.

Friday:
5 CORE 40 questions
Patented organisms: jigsaw sharing, sketches.

April 26th-May 4th

2009-04-23T17:26:00.001-07:00

Friday:
1.) Paramecium and Equilibrium-half sheet.
2.) Stapled to half sheet students connect the standards to the pond water activity and slides we looked at.

Monday: Chap. 19 Quiz, Swine Flu, and Gum Article

Tuesday: Article Reading about Egg Donation hand in at the end of the period.

Wednesday:
Watch videos on egg donation, describe IVF
Go through egg donor application
Go over multiple choice questions
Reading of positions.
Cards until the end of the period.

Thursday
Frog Video and questions.

Friday:
Frog video poster as importance for other freshman.
Protect the Frogs Poster and Website Creation?
Why their important? What are current threats? How can I help?

Monday: Paramecium Homeostasis questions. Homeostasis Game, Paramecium review.

Tuesday: Finish Homeostasis, cards until the end of the period.

Wednesday: Genetics Review

Thursday: Maybe Comp. Lab?

Friday: Mouse Party, Re-examine pond water later in the season?

Pond Ecosystem Exploration, Egg Donation

2009-04-16T15:08:00.000-07:00

Friday:
Five Multiple Choice Questions
1.) Questions we have about the water in the "stream" and pond.
2.) Walk to stream and pond, collect samples.
3.) Pyramid review after the pond walk.

Monday:
Five Multiple choice questions.
Setting up and using microscopes to look at pond water, using vinegar drop on slide to see impact of acid on organisms. Product: Pictures and descriptions of water animals and water moneras and water protists. At least one of each. Labeled sketch of each.
1.) Going through how to use and parts of microscope lab.

Tuesday:
Five multiple choice questions
Goal: What's in our pond water and what does it do for the ecosystem?
Finish Lab Sheets from yesterday.
1.) Using microscopes find as many different organisms and sketch them, label them, and hypothesize what they do for the ecosystem.
2.) On other side of paper, sketch and label a variety of protozoans and blue green algae to determine what could be in the pond water.
Protozoans: Hydra, Pelomyxa, Plasmodium, Ameoba, Trypanosoma, Euglena, Stentor, Vorticella, Stemonitis
Algae: Diatoms, Desmids, Protococcus, Fucus, Polysiphonia, Zygnema, Nostoc, Ulothrix,
Bacteria (No Nucleus): Clostridium Botulinum, Rhizobium Leguminosarum, Tuberculosis, Oscillatoria, Corynebacterum diphtheriae.

Wednesday:
Five Multiple Choice questions
Goal: Determine the affect of making pond water more acidic, basic, salty, and sugary.
1.) Adding a drop of vinegar to wet mount then a drop of pond water. Examine and record.
2.) Adding a drop of pond water then adding baking soda to make basic.
3.) Adding a drop of pond water then adding salt to make hypertonic.
4.) Adding a drop of pond water then adding sugar to make hypertonic.
5.) Adding a drop of detergent then adding pond water.
For each trial, students make a hypothesis (If I..., then..., because...) about the outcome of doing the experiment.
They then record the results in pictorial and written form with an explanation about why the results may have turned out this way.

Thursday:
Five multiple choice questions
Contractile Vacuole Gizmo with questions.
Random Slides of interest.
Reflection: "What did I learn/reinforce from the pond exploration related to homeostasis, the cell, the tree of life or evolution, and ecosystems.

Friday: Homeostasis Game.
Five multiple choice questions.
Flex day
Review Gardasil with the video and controversy surrounding Gardasil.
Homeostasis Gizmo and Questions.
Tom Dermody Visit

Monday: Frogs in Danger Video
Tuesday: Frogs in Danger Video Finish and Poster Creation.

Wednesday
Goal: Review Principles of Genetics
1.) Vocabulary Review matching for genetics.
2.) Genetics with coins lab

Thursday
Goal: Students describe situation related to egg donation.
1.) Review Mitosis vs. Meiosis
1a.) IVF Videos on delicious website.
2.) Craigslist information, compensation for egg donation.
3.) Scenario:
Your mom's sister, "Stacey" has been married to your uncle "Wally" for ten years. They are now both 36 years old. Stacey has cystic fibrosis and your uncle is a carrier. They have had 4 miscarriages that doctors think is related to the embryo having cystic fibrosis. Your aunt and uncle are offering you $30,000 for 4 egg donation cycles.

Men: Your fiance (CC) is thinking about selling her eggs to help pay off her school debt.
Ladies (CC): You have $30,000 of college debt and are looking to sell your eggs to help pay the debt.
The interest on the loan is 7%. The monthly payment is $269.65. Both you and your wife have just graduated from college with a major in your desired field.
3.) What are other questions you want answered? What are the effects of egg donation? What are the pros/cons?
4.) Watch "How to become an egg donor?"
5.) On sheet of paper write out pros and cons of egg donation (tee chart)
6.) Look up details about egg donation and impacts. Details, Pros, Cons.
7.) Punnet Square Science Review Games.

Friday
Goal: Egg Donation position statements and CORE 40 practice cards.

Monday
1.) Egg Donation Statement Readings. Core 40 practice cards.

Week before spring break, Cell Membrane and Function

2009-03-24T18:12:00.000-07:00

Monday: Data Collection on Food Intake of Freshmen:
1.) Students Find average caloric intake of female, male, BMI categories.
2.) Students make five observations of data related to calories, fats, proteins, and carbohydrates.

Tuesday: Date presentations of Food Intake of Freshman:
1.) Students make bar graphs comparing consumption of calories, fats, proteins, and carbohydrates.
2.) Save to the wikispace.
3.) Students hypothesize reasons why there were such differences between groups of students.
4.) Contractile Vacuole Explorelearning activity. A contractile vacuole pushes water out of the cell.
"When is the contractile vacuole the most active" Why?
"When is the contractile vacuole the least active?" Why?
"Under what conditions does a cell absorb water naturally?"
"Under what conditions does a cell lose water naturally?"
"What would happen to the paramecium if the contractile vacuole did not work properly?"

Wednesday: Students describe the different ways the cell maintains homeostasis.
Engage: Homeostasis Discussion: Pop Can Illustration, Salt and Sugar discussion

Cell Membrane Analogy poem:
Name things that has a lot of different things that are a part of it.
Name things that make travel easier.
Name things that are used to identify people.
Name things that are used stabilize other things.
Name things that have two different parts.
Name things that contain energy.

1.) Cell membrane power point and youtube videos.
2.) Cell membrane analogy poem. With a sketch of the cell membrane. Picture showing the structure and function of the cell membrane. Include the following: Phospholipid bilayer, membrane proteins, ATP, Glycoproteins, cholesterol.

Thursday: Mice on drugs interactive.
Follow the print out.

Friday: Core 40 league play.
Cell Membrane Quiz.

Proteins, Food Label, then Prescription Drug Unit

2009-03-14T06:16:00.000-07:00

Monday: predict the food product based on the nutrition label but not the ingredients.
1.) Notes on Protein Structure and Function. *Use from online ppt.
2.) Quadrafold Structure of Proteins and a Quadrafold Function of Protein four way foldable for homework.

Tuesday:
Determine the amount of grams of the 3 major macromolecules you ate.
Practice Multiple Choice Questions
1.) Go to Body Mass Index calculator on line.
2.) Nutrition Facts.com Look up the foods you ate and determine the number of grams of protein, carbohydrates, and fats you ingested yesterday.
3.) Answer the following questions about your food consumption.
What is the recommended daily intake of protein/lipid/carbohydrates for someone your size?
What was your intake of those yesterday?
How could you get closer to this amount?
What could you have done differently?
4.) Succession review game.
5.) RNA and Protein Synthesis Game.

Wednesday:
1.) Why does acid smell bad? Why does rotten food not look good? Discussion of evolution of senses to protect humans.
2.) Record heights for plants in the water, acid, base experiment.
3.) Egg white observations.
4.) Protect your proteins Public Service Announcement.

Thursday:
1.) Review structure and function of proteins.
2.) Have labels throughout the room, students record the data and try to determine the food from the clues. Giving a rationale for their decision.

Friday: Protein Structure and Function Quiz.
Another round of league play.

Prescription Drugs Unit Overall Goal: Determine the structure and function of a prescription drug.
Monday:
Day One: Goal: Review the structure and function of neurons.
Jumping the Gap overhead.

Day Two: Goal: Determine the structure and function of drugs.
Mouse Party online activity.

Day Three: Goal: Overview of prescription drugs.
1.) Reading on process of FDA approval of Prescription drugs.
2.) Prescription Drug ppt. research.

Day Four: Goal: Learn from other's prescription drug research.
Go from cellular level to organismal level and symptoms.

Metabolism

2009-03-08T14:23:00.000-07:00

Thursday
Goal: Describe Metabolism, Glycolysis, Krebs Cycle, Electron Transport, ATP, and Energy Production.
1.) Create List of ways we use energy.
2.) Create list of ways we obtain energy.
3.) Describe sucrose and fructose as 6 carbon sugars that are converted in energy through respiration. (Direct notes)
4.) ppt. discussion

Friday
Goal: Describe the process of respiration and sugar breakdown.
1.) Making chose your own adventure book of how glucose gets broken down into carbon dioxide. (Glycolysis, Krebs, Fermentation)
2.) Test Corrections.

Monday
Goal: Analyze features of different sugar substitutes and their effects on humans.
1.) Introduce sugar substitutes.
2.) Online Metabolism Survey.
3.) Computer Lab Sugar substitutes research and ppt. completion.
4.) Possible Sugar Substitutes: Sucralose, Splenda, Aspartame, Dulcin, Cyclamate, Saccharin, Neotame, Acesulfame-K, and Lead Acetate.
Helpful Links
FDA Approved Sweeteners
Elmhurst College Artificial Sweeteners Site.

Wikipedia Sugar Substitutes Comprehensive Listing and Discussion of Major Artificial Sweeteners.
Cancer and Artificial Sweeteners (Cancer.gov)
How stuff works: Artificial Sweeteners
Coca-Cola Information on Artificial Sweeteners

Tuesday: Catch Up, Review Cards.

Wednesday
Goal: Analyze features of different sugar substitutes and their effects on humans.
1.) Finish Sugar Substitute Research ppt.
2.) Cell Parts Basketball.
3.) Respiration Basketball.
4.) Heterotrophic vs. Autotrophic basketball. Hint: CO2 is inorganic while sugar is organic.

Thursday
Goal: Students explain sugar breakdown steps and metabolism test.
1.) Reading each other's books.
2.) Carbon Cycle Game. (with Core 40 Cards)
3.) Quiz tomorrow.

Friday
Goal: Students describe the process of IVF and egg donation.
1.) Carbon Cycle Quiz-Review notes and book.
2.) Examine Acid, Water, Baking Soda Plant Lab. ?, Hypothesis, Results, Conclusion.
2.) Science Core 40 deck game.

Biological Sequences and IVF, Egg Donation

2009-02-27T17:01:00.001-08:00

Monday: Pea plant observations, review for essay test.

Tuesday and Wednesday: Essay Test.
I.) Explain how HPV causes a tumor in a skin cell. (All ___ steps included) Key Words: abrasion, DNA, virus, mutation, mitosis, genes, protein, skin cell, pluripotent stem cell)
1.) Human papillomavirus gets into a skin abrasion.
2.) The HPV goes through the cell membrane of a skin stem cell. This cell in beneath the outer layer of skin.
3.) The DNA of HPV then inserts into the DNA of the host cell. This causes a mutation in the host cell.
4.) This mutation causes bad proteins to be made so the cell loses control of the cell cycle (mitosis)and the host cell then divides uncontrollably. This creates a tumor (wart)
5.) If a cancer cell gets into a blood vessel, then it can spread throughout the body.

II.) How does a stem cell become a different type of cell? (All ____ steps included)Key Words: Differentiation, signal, DNA, cell membrane, gene expression, potential, functions)
1.) Stem cells hang out until they receive a signal which is received on the cell membrane and in the nucleus
2.) Once the cell receives a signal, a portion of the DNA is activated and genes are expressed creating a protein.
3.) Those proteins then make the cell become somewhat different to perform different functions throughout the body.

III.) Explain the difference between mitosis and meiosis (at least 4 differences).
1.) Meiosis produces sex cells while mitosis produces body cells.
2.) Meiosis happens in reproductive organs while mitosis throughout the body.
3.) Meiosis has chromosomes line up in tetrads while mitosis has chromosomes line up in pairs.
4.) Meiosis makes 4 different cells while Mitosis makes 2 identical cells.

IV.) Explain how Gardasil protects a body against HPV. Key words: protein, DNA, immune system, cell membrane, nucleus, stem cells, antibodies)
1.) The vaccine contains the proteins that form the outer shell of HPV. (but does not actually contain the HPV DNA)
2.) The body's immune system creates antibodies to fight the proteins in the vaccine.
3.) These antibodies stay in the blood stream to fight any real HPV infections that would try to infect skin stem cells.

V.) Explain how DNA codes for a protein.(All ____ steps included)Key Words: DNA, transcription, DNA Helicase, RNA polymerase, mRNA, Translation, tRNA, Ribosome, Nucleus, Amino Acids, Protein, Polypeptide, enzymes):
1.) The cell receives a signal telling the DNA to activate to start protein production.
2.) Transcription happens in the nucleus. The enzyme DNA helicase unwinds the DNA while the RNA polymerase enzyme starts to make mRNA from the DNA code.(A matches U, T matches A, C matches G, and G matches C).
3.) The mRNA travels through the nuclear membrane from the nucleus to the ribosome.
4.) Translation happens: Ribosomes read the mRNA code to have tRNA bring amino acids to the ribosomes.
5.) The amino acids join together to form a polypeptide which is also known as a protein.

VI.) Explain how natural selection and evolution produces the five major kingdoms of Monera, Protista, Animalia, Plantae, and Fungi.
1.) Organisms overproduce in making offspring
2.) The offspring are not exactly the same (they have different DNA), therefore there is variety.
3.) Some offspring reproduce more often because of having favorable traits.
4.) Over time, the population changes gradually creating a new species.
5.) This process continues to occur as environmental factors change, and populations continue to evolve.

VII.) What are three things a cell must do before it divides?
1.) Grow
2.) Copy its DNA
3.) Have the DNA go to different sides of the cell.

Thursday:
Goal: Describe issues related to egg donation.
1.) Intro to IVF (youtube).
2.) Video on IVF (CBS)
3.) Read and summarize article over egg donation.

Friday:
Goal: Describe pros and cons related to egg donation.

Gardasil Considerations, Egg Donation

2009-02-25T16:07:00.000-08:00

2/26
Goal: Students determine the characteristics of monera and protista that could survive on another planet.
1.) Astrobiology go fish game.
2.) What is IVF video (delicious website)?

2/27
Goal: Students determine pros and cons of Gardasil Vaccine.
1.) Scenario: You are the parent of a daughter in the 9th grade. The State of Indiana is encouraging you to have your daughter get the Gardasil Vaccine. What will you have your daughter do?
2.) Reading HPV wikipedia article.
3.) Taking notes in on a T-chart for pros and cons of getting the Gardasil Vaccine.

3/2
Goal: Students determine pros and cons of Gardasil Vaccine.
1.) Obtain a list of pro's and con's to having a daughter get the Gardasil Vaccine. Get at least seven pro's and 7 con's with source (Author, Publication, and Date)
Goal: Write a letter to your spouse about your position whether you want your daughter to get Gardasil vaccine.
2.) Assume your spouse feels the opposite of you.
3.) A=refute 4 of your spouse's points in 4 paragraphs.
B=refute 3 of your spouse's points in 3 paragraphs.
C=refute 2 of your spouse's points in 2 paragraphs.
D=refute 1 of your spouse's points in 1 paragraphs.

3/3
Goal: Write a letter to your spouse about your position whether you want your daughter to get Gardasil vaccine.
1.) Assume your spouse feels the opposite of you. Finish your letter today.
2.) A=refute 4 of your spouse's points in 4 paragraphs.
B=refute 3 of your spouse's points in 3 paragraphs.
C=refute 2 of your spouse's points in 2 paragraphs.
D=refute 1 of your spouse's points in 1 paragraphs.
3.) Hand in for draft to teacher.

3/4 Goal: Students revise their papers and type and print. Indiana State House Vote, email Indiana state representatives?

3/5 Goal: students describe the process of HPV causing cervical cancer.
1.) Handout key for the next test, students read over the questions and the key.
2.) Introduce sequential game format.
3.) Have students play HPV and Natural Selection Sequential Game.
4.) Astrobiology Go Fish?

3/6 : Start with egg donation arguments.
Goal: Students describe situation related to egg donation.
1.) IVF Videos on delicious website.
2.) Craigslist information, compensation for egg donation.
3.) Scenario:
Your mom's sister, "Stacey" has been married to your uncle "Wally" for ten years. They are now both 36 years old. Stacey has cystic fibrosis and your uncle is a carrier. They have had 4 miscarriages that doctors think is related to the embryo having cystic fibrosis. Your aunt and uncle are offering you $30,000 for 4 egg donation cycles.

Men: Your fiance (CC) is thinking about selling her eggs to help pay off her school debt.
Ladies (CC): You have $30,000 of college debt and are looking to sell your eggs to help pay the debt.
The interest on the loan is 7%. The monthly payment is $269.65. Both you and your wife have just graduated from college with a major in your desired field.
3.) What are other questions you want answered? What are the effects of egg donation? What are the pros/cons?
4.) Watch "How to become an egg donor?"
5.) On sheet of paper write out pros and cons of egg donation (tee chart)
6.) Look up details about egg donation and impacts. Details, Pros, Cons.
7.) Punnet Square Science Review Games.

3/9
Goal: Students determine the pros/cons related to egg donation.
1.) Article Reading.
2.) Internet research and posting on the blog your summaries of pros and cons.

3/10
Goal: Students make decisions based on biological evidence.
1.) Reading of all pros and cons.
2.) Assume your fiance feels the opposite of you about donating eggs. Writing letter to fiance about your position trying to convince them of your position.
A=4 well explained paragraph showing important details.
B=3 well explained paragraph showing important details.
C=2 well explained paragraph showing important details.
D=1 well explained paragraph showing important details.
3.) Write a note to your aunt or uncle explaining your position as a family.

3/11
Goal: Test, Stem Cells, Evolution, Egg Donation, IVF, Punnet Squares.
Test (record all the food and approximate sizes of the food you ate today)

3/12
Goal: Students calculate the number of grams of proteins, fats, and carbohydrates eaten in a day.

Finish Stem Cells, Kingdoms of Life, Egg Donation

2009-02-12T16:26:00.000-08:00

2/13
Goal: Students determine pros and cons of embryonic stem cell research.
1.) Review process of differentiation.
2.) Go over posting pros and cons guidelines.
3.) Research and posting.

2/16
Goal: Students read evidence and determine their position on funding embryonic stem cell research.
1.) Reading over all the evidence collected.
2.) Final comments.
3.) Vote and paragraph defense using evidence.
4.) Writing letter to Senator.

2/17
Goal: Students classify organisms using characteristics of those organisms.
1.) NOVA evolution and Darwin clip/animal classification online game/embryology video.
2.) Using characteristics students create a tree that shows the relationships between the organisms.
3.) Students walk around the room to look and talk with other students about the tree of life they created.
4.) Students adjust the tree of life for themselves.
5.) Students note the trees on a blank sheet of paper.

2/18
Goal: Students determine the characteristics of the different kingdoms of life.
1.) Making and recording tree of life.
2.) Graphic Organizer completion.
3.) Using the same cards as before, students classify the organisms into their kingdoms.
4.) Students study notes.

2/23
Goal: Students determine the characteristics of the different kingdoms of life.
1.) CORE 4O review/Potato Observations/Pea Planting start
2.) Students place particular characteristics of kingdoms into categories.
2.) Species charades using the organism cards.
3.) Jeopardy Kingdom review

2/24
Goal: Students determine the characteristics of monera and protista that could survive on another planet.
1.) Writing emails to Senators-Reading CORE 40 assessment online information.
2.) Astrobiology matching/go fish game.

2/25
Goal: Students determine the characteristics of monera and protista that could survive on another planet.
1.) Astrobiology go fish game.

2/26: Start with egg donation arguments.
Goal: Students describe situation related to egg donation.
1.) Article Reading. Craigslist information.
2.) Scenario: Men: Your fiance wants to sell her eggs to help pay off her school debt. Ladies: You have $30,000 of college debt and are looking to sell your eggs to help pay the debt. The interest on the loan is 7%. The monthly payment is $269.65. Both you and your wife have just graduated from college with a major in your desired field.
3.) What are other questions you want answered? What are the effects of egg donation? What are the pros/cons?

2/27
Goal: Students determine the pros/cons related to egg donation.
1.) Internet research and posting on the blog your summaries of pros and cons.

3/2
Goal: Students make decisions based on biological evidence.
1.) Reading of all pros and cons.
2.) Writing letter to fiance about your position.

3/3
Goal: Test, Stem Cells, Evolution, Egg Donation, Parkinsons.
Test

CF, Prep for Field Museum and Shedd Aquarium

2009-02-01T07:22:00.000-08:00

Monday:
Goal: Students rationalize decisions about whether or not to have a child with a 25% chance of cystic fibrosis.
1.) Reading positions, editing positions for final submission.

Tuesday: Students determine the environment and adaptations of five different phylum at the Shedd Aquarium.
1.) Students complete research grid: Animal, Phylum, Environment, Adaptations, Distinct Features, chromosomes.

Wednesday: Students explain the process by which stem cells differentiate.
1.) Students go through Utah Genetics Stem Cell Interactive taking notes on the different stem cell differentiation.
2.) Reading of stem cell research article presenting both sides.

Thursday: Students self assess their understanding of state biology standards.
1.) Students read the state standards and rate themselves 1-4 based on their level of understanding.
2.) Collection of data on each of the standards. Students average their understanding which the larger standards indicators.

Friday:
1.) Field Museum online exploration. Students determine which exhibits they would like to visit, they also correlate the exhibits to the CORE state standards.
2.) Table will have the columns: Exhibit, State Standard, Floor, Artifacts.

Monday: Field Trip

Tuesday: Write a Field Trip Reflection.
1.) Brainstorm highlights.
2.) Three paragraphs (favorite three artifacts and why, things seen related to biology class, ways to improve the trip, was it worth the day away from school and $20 explain, a thanksgiving paragraph)

Wednesday: Stem Cell Research Siding.
1.) Review process of stem cell differentiation.
2.) Read aloud article for stem cell.
3.) Watch Frontline: Parkinsons Syndrome
4.) Reading of scenario. (Fast forward 30 years in your life) You are a senator in the United States Senate. The House of Representatives has just passed a US Budget that includes $50,000,000 for embryonic stem cell research. Your job is to research the reasons for and against embryonic stem cell research. You will share your research in a discussion in an upcoming class period. At the end of the discussion, we will vote to determine if the class would include $50,000,000 in their budget.

Thursday: Finish Video, do more research.
Pros and Cons of stem cell research.
Answering questions in the computer lab about stem cell research. (Have reference for each fact, not just website, but actual organization)

Friday:
Position on Stem Cell research and why. Will you vote for the bill? Why or why not. Type up all reasons for and against embryonic stem cell research.

Monday:
Debate and vote for or against stem cell research. Write final draft for letters about stem cell research.

Genetics Continued

2009-01-22T16:43:00.000-08:00

Friday: (using simple print out where students cut their own chromosomes out)
Four chromosomes gamete production. 1-Dark (DD), Tallness (TT), Attached/Detached (AA), Long/Short nose (LL): 2-Dark, Tallness, Curl of Tongue (CC): 3-Dark, Tallness, 4: Femininity (FF). Students write their own parents' traits on the chromosomes. They then take their chromosome through meiosis. After meiosis, they combine their gametes with other students gametes to predict offspring. (6-5 T's=over 6 feet, 3-4 T's=5.5-6 feet, 1-2 T's=5-5.5 feet, 0 T's=less then five feet.) 6-5 D's=very dark, 3-4 D's=moderately Dark, 1-2 D's=light, 0 D's very pale), AA or Aa attached, aa detached: LL long nose, Ll, medium nose, ll short nose, CC or Cc can curl tongue, FF=female, FO=male.

Monday:
Goal: Test hypothesis relating to two traits in mice, and make claims based on the data. Make a punnet square to describe two trait cross (dihybrid cross)
1.) Go through Mendel's dihybrid cross example in the textbook. Coach and Model.
2.) Have students make a dihybrid cross prediction of the mice two traits gizmo.
3.) Have students complete two traits in mice gizmo on their own.

Tuesday:
Mendel Notes and ppt.
Students make a Mendel Picture with quotations related to his contributions to science.

Wednesday: PI Nicotine Addiction investigation.

Thursday:
1.) Dihybrid and Mendel Quiz
2.) GOAL: Apply Genetics and Organism knowledge to life decision related to cystic fibrosis.
3.) Cystic Fibrosis Situation Discussion and research answering-writing your position as a rough draft.

Friday: Continued Research. Typing your position and continued research.
Done with Position?-->Cloning interactive

Finish Genetics, Mendel

2009-01-18T07:32:00.000-08:00

Monday:
Goal: Students describe Mendel's contribution to science (blabberize)
1.) Review Punnett Squares using one and two traits
2.) Direct Instruction, Mendel's papers contribution to science-Reading Laws of segregation and independent assortment.
3.) Computer Lab-Mendel's Traits exploration. Determine the traits Mendel worked with and which trait is dominant.

Tuesday:
Goal: Differentiate between mitosis and meiosis.
Review Independent Assortment and Segregation.
Review Mitosis with model red and blue chromosomes.
1.) Meiosis Steps using model chromosomes. Students write out their parents traits on the paper chromosomes. Students also write the number that each chromosome is playing the model of. Each table gets one paire of red chromosome sets and one pair of blue chromosome sets. Students take these chromosomes through mitosis and meiosis.
2.) Students then read chapter 10 and answer questions.

Wednesday
Goal: Describe the steps to meiosis. Differentiate between meiosis and mitosis-using graphic organizer.
Into: Dwarfism inhertiance. Reinforce vocabulary.
1.) Watch meiosis square dance and sy video.
2.) Watch mitosis video.
3.) Complete Model meiosis.
3.) Reading and answering questions on Meiosis with Model in front.

Thursday
Goal: Mitosis, Meiosis, or both quick review game (have students make cards that have a statement on one side and Mitosis, Meiosis, or both on the other.
Answer questions from end of Chapter 10.
1.) Review Meiosis with models.
2.) In class Karyotype activity.
3.) Karyotyping in Computer Lab.

Friday: Connect chromosome genetics to Mendel's Laws of Segregation and Independent Assortment.
1.) Porfolio putting together.
2.) Mendel's Laws of Independent Assortment and Law of Segregation.
3.) Tree Man.
4.) Pyramid.

Monday:
Goal: Test hypothesis relating to two traits in mice, and make claims based on the data. Make a punnet square to describe two trait cross (dihybrid cross)
1.) Go through Mendel's dihybrid cross example in the textbook. Coach and Model.
2.) Have students make a dihybrid cross prediction of the mice two traits gizmo.
3.) Have students complete a dihybrid cross example on their own. Fade- Computer Lab.

Tuesday: PI Nicotine Addiction investigation.

Wednesday:
Four chromosomes gamete production. 1-Dark (DD), Tallness (TT), Attached/Detached (AA), Long/Short nose (LL): 2-Dark, Tallness, Curl of Tongue (CC): 3-Dark, Tallness, 4: Femininity (FF). Students write their own parents' traits on the chromosomes. They then take their chromosome through meiosis. After meiosis, they combine their gametes with other students gametes to predict offspring. (6-5 T's=over 6 feet, 3-4 T's=5.5-6 feet, 1-2 T's=5-5.5 feet, 0 T's=less then five feet.) 6-5 D's=very dark, 3-4 D's=moderately Dark, 1-2 D's=light, 0 D's very pale), AA or Aa attached, aa detached: LL long nose, Ll, medium nose, ll short nose, CC or Cc can curl tongue, FF=female, FO=male.

Thursday: Cystic Fibrosis Situation Discussion and research answering-writing your position as a rough draft.
Thursday: Typing your position and continued research.
Friday: Reading positions.
Monday: Correcting positions.

Tuesday and Wednesday:
Start Egg Donation Debate Reading and Discussing Article. What we know? Want to know? Research

Biology Debates: Project Presentations

2009-01-13T16:56:00.000-08:00

After Genetics, Meiosis, and Mendel.

Debates: In life chronological order.
Format:
1. Read scenario. Initial discussion.
2. Research in the computer lab-List details about science related to issues and source of each detail. End of Day one.
3. Determine what side you will be on. Teacher assigns roles in the debate. Prepare for the following day.
4. Group debate/discussion of the scenario.
5. Follow with changes in the scenario and supposition of how things would change.
6. Student write a paper that summarizes their stance on the scenario. Necessary requirements: 3 reliable sources, evidence for stance, logical explanation of why they would do what they would do.

Topic One:
Should women be able to donate their eggs for money?
You have daughter who is 23 years old and single. She is a junior in college and has $30,000 in college debt. She is thinking of selling her eggs for $1200 per cycle. What will you do as a parent? What do you suggest she do? Why?

Topic Two
Should the government provide funding for stem cell research
You are a US Senator from Indiana who must vote on the nation's budget. The current proposed budget includes money for embryonic stem cell research. Do you vote for the budget? Do you vote against the budget? Why?

Topic Three
You are a parent of a an autistic child, Sallie. Sallie first showed signs of autism after receiving her Measles, Mumps, Rubella vaccine (MMR). You now have a child, Michael who is two months away from having his MMR shot. What do you do? Why?

Topic Four
Should the government require people to vaccinate people with the gardasil vaccine?
You are the parent of a 13 year old girl. The government is requiring you to have your daughter vaccinated against the virus that is linked to cervical cancer. No one in your family has ever gotten cervical cancer. Your daughter is not sexually active.

Topic Five
Should schools use wireless internet?

Topic Six
You are married, 26 years old, with one child. Your mother is showing signs of Alzheimer's disease. The last time see came to your house she got lost. You usually have the same conversations at least twice if you are around her during the day. Your dad is still alive. Your grandmother on your dad's side had alzheimer's disease. What do you do about your mom? What do you say to your dad? What do you do about your own future?

Presentations/Research:
Biological Patents

Prescription Medicine

Starting the Second Semester-Genetics

2008-12-19T03:41:00.001-08:00

Topics to be covered this semester include the following...
Meiosis, Genetics, Development, Metabolism

Wednesday
Goal: Students test hypothesis regarding inheritance of a single trait using an online simulation and make a claim regarding their experiments.
1.) Students complete a single gene inheritance gizmo while testing hypothesis using a lab sheet.
2.) The specific gizmo is Mice Inheritance Single Trait, Mice Inheritance Two Traits.
3.) On lab sheet students make a list of claims to summarize their results.
4.) Students share their claims with 10 minutes left in class.
Assessment: Lab sheet and Claims discussion.

Thursday
Goal: Students comprehend vocabulary related to basic inheritance.
1.) Direct instruction on vocabulary-Vocab list and write in own words based on mouse demo and teacher explanation: allele, gene, phenotype, genotype, trait, heterozygous, homozygous, hybrid, pure breed, cross, F1 generation, F2 generation, carrier, dominant, recessive.
2.) Four Genetics basics videos on Youtube delicious.com/jgensic

Friday
Goal: Students apply their understanding of genetics to Punnett Squares.
1.) Four Genetics basics videos on Youtube delicious.com/jgensic
2.) Punnett Square Practice-Spongebob genetics.
3.) Pyramid vocabulary development
Assessment Spongebob Genetics.

Monday:
Goal: Test hypothesis relating to incomplete dominance in chickens, and make a claim based on the data.
1.) Spongebob review. Same as last Wednesday but with codominance in chicken.

Tuesday: Snow Day

Wednesday:
1.) Youtube video review
2.) Start potato and Pasteur experiment (make hypothesis and write out experimental steps).

Thursday:
Mendel's contribution to science (blabberize)
Laws of segregation and independent assortment.

Friday:
Goal: Differentiate between mitosis and meiosis.
Meiosis Steps using model chromosomes. Students write out their parents traits on the paper chromosomes. Students also write the number that each chromosome is playing the model of. Each table gets one paire of red chromosome sets and one pair of blue chromosome sets. Students take these chromosomes through mitosis and meiosis.
Students then go through the room with their gametes produced in meiosis and see how their babies would turn out.

Monday
Goal: Describe the steps to meiosis. Differentiate between meiosis and mitosis-using graphic organizer.
1.) Watch meiosis video.
2.) Watch mitosis video.
3.) Use a graphic organizer to analyze meiosis and mitosis. (teacher led creation of the graphic organizer: Where do they take place? What do you start with? What are the finished products? What are the steps? Key differences?
4.) Reading about meiosis.

Tuesday:
Goal: Mitosis, Meiosis, or both quick review game (have students make cards that have a statement on one side and Mitosis, Meiosis, or both on the other.
Answer questions from end of Chapter 10.

Wednesday
Goal: Test hypothesis relating to two traits in mice, and make claims based on the data.

Thursday
Goal: Assess the use of punnett squares to predict offspring genotypes and phenotypes one trait and two traits.

Friday
Students do role play meiosis and trait combination.

Mutations and Finishing the Semester

2008-12-07T11:57:00.001-08:00

Monday: 12/8
Goal: Describe the different types and sources of DNA mutations.
Review: DNA Dance on Youtube,
1.) Engage: DNA replication online activity (Nobel Prize Game Site)
2.) Explain: Mutation is any alteration in a cells DNA, DNA Mutation: Youtube, DNA Repair: Youtube.
3.) Read and Notetaking on section 11.3.
Assessment: Answering end of section questions in 11.3

Tuesday: 12/9
Goal: Students make connections between key concepts covered in first semester.
1.) Go over and collect homework.
2.) Introduce key ideas and vocabulary review poster project.
3.) Students work in pairs on vocabulary and concept mapping review project.
Assessment: Completing the concept map.

Wednesday: 12/10
Goal: Students describe the impact of DNA mutations on the human organism.
1.) Introduce and model how to complete DNA mutation slides for research.
2.) Show link to DNA Nobel Prize game.
3.) Go to computer lab for Nobel Prize game and DNA mutation research.
Assessment: Completed slides.

Thursday: 12/11
Goal: Students describe the impact of DNA mutations on the human organism.
1.) Go to computer lab for DNA mutation research.
2.) When done students share their slideshows with other students who are done.
Assessment: Completed slides.

Friday: 12/12
Goal: Students apply the concepts of DNA mutation to Rudolph the red nosed reindeer.
1.) Review the steps to Natural Selection.
2.) Provide christmas natural selection handout lab.
3.) Students complete the graphing and questions to the lab.

Monday: 12/15:
Goal: Review for final.
HPV and Gardasil explanation.
1.) Curious Questions awaiting research?
2.) Start beans in the test tubes research.
3.) Review pyramid.

Tuesday 12/16
Goal: Review for final
1.) Curious Questions awaiting research?
2.) Beans and natural selection with no fan.
3.) Review poker.

Wednesday 12/17:
Goal: Review for final

Thursday 12/18
FINAL EXAM

Friday
Jurassic Park

Replication, Transcription, Translation

2008-11-23T15:20:00.000-08:00

Monday: 11/24
Goal: Students finish creating two stands of 9 DNA and make 20 extra nucleotides in groups of four.
1.) Direct Notes: Structure of DNA.
1.) Students cut 40 purple pentagons (all the same color and same size), 40 circles (same color and size), (12 Cytosine's and 12 Guanine's G's), 8 Adenine's and 8 thymine and 8 Uracil's (same shape as U's)
2.) Students then create one strand of 10 nucleotides and then a complementary strand to that strand that matches up with the first strand. (5'-TACGATATC-3')
3.) Practice replication with pieces?
Assessment: Completion of the two strands.

Tuesday: (2 hr Delay): watch replication clips, complete replication with DNA models.

Wednesday: 11/25
Goal: students complete graphic organizer comparing replication, transcription, and translation.
1.) Read Section 11.1
2.) Quiz-Replication and DNA Structure
Start going over graphic organizer: Replication, Transcription, and Translation.
2.) Students complete a graphic organizer related to replication, transcription, and translation.
3.) Show animations of replication, transcription, and translation.
Ending Discussion: How are transcription and translation related?
Assessment: Quiz

Monday: 12/1
Goal: Transcription, Translation, Replication Graphic Organizer. Describe, act-out, and explain the steps to transcription.
Direct Notes: Structure of RNA=Compare to DNA.
1.) Finish Graphic Organizer
2.) Go over transcription steps in a list
3.) Go over transcription in a video
4.) Go over transcription by completing it by hand
Assessment: Write your own steps to transcription by hand on a half sheet.

Tuesday: 12/2
Goal: Transcription, Translation, Replication Graphic Organizer. Describe, act-out, and explain the steps to translation.
1.) Go over translation steps in a list
2.) Go over translation in a video
3.) Make three tRNA molecules that bond have amino acids bonded to them.
4.) Go over translation by completing it by hand
Assessment: Write your own steps to translation by hand on a half sheet.

Wednesday: 12/3
Goal: Act out transcription and translation together.
1.) Go over steps to transcription and translation.
2.) Watch video of both together.
3.) Act out using the models.
4.) Quiz over Graphic Organizer

Thursday: 12/4
Goal: Students reinforce transcription and translation using computer models.
1.) Computer lab going over transcription and translation at U of Utah site.
2.) When done complete Nobel Prize game over DNA.

Friday: 12/5
DNA TEST: KNOW your graphic organizer and how to transcribe and translate a DNA strand.

Monday: 12/8
Goal: Distinguish between replication, transcription, and translation, RNA, DNA
Show animations of transcription and translation.
Classification of DNA activities and descriptions at each desk.

Tuesday and Wednesday: 12/9 and 12/10
Goal: Describe the four different types of genetic disorders. Select one disorder summarize causes and symptoms.

Replication, Transcription, Translation

2008-11-07T15:19:00.001-08:00

Friday
Goal: relate cell cycle to cancer and everyday decisions.
1.) Finish Cancer Project
2.) Play Cell Cycle Nobel Prize Game
3.) Finish Millionaire Questions.
Assessment: Cancer project handouts

Monday
1.) Read Sections 8.2 and 8.3
2.) Test Concepts (cell cycle, cancer, cell parts)
Assessment: Test Tomorrow

Tuesday
Goal: Students demonstrate understanding of cell cycle and its relationship to life. (Start cutting to make DNA strands)
1.) Test
2.) DNA cutting start (pentagons for sugar, circles for phosphates, fitting shapes for A's T's C's and G's

Wednesday:
Goal: Students create two stands of DNA and make 20 extra nucleotides in groups of four.
1.) Direct Notes: Structure of DNA.
1.) Students cut 40 purple pentagons (all the same color and same size), 40 circles (same color and size), (12 Cysteine's and 12 Guanines's G's), 8 Adenine's and 8 thiamine and 8 Uracil's (same shape as U's)
2.) Students then create one strand of 10 nucleotides and then a complementary strand to that strand that matches up with the first strand.
3.) Practice replication with pieces.

Thursday
Goal: students complete graphic organizer comparing replication, transcription, and translation.
1.) Start going over graphic organizer: Replication, Transcription, and Translation.
2.) Students complete a graphic organizer related to replication, transcription, and translation.
3.) Show animations of replication, transcription, and translation.
Exit Card: How are transcription and translation related?

Friday:
Goal: Transcription, Translation, Replication Graphic Organizer. Describe, act-out, and explain the steps to transcription.
Direct Notes: Structure of RNA=Compare to DNA.
1.) Go over transcription steps in a list
2.) Go over transcription in a video
3.) Go over transcription by completing it by hand
4.) Write your own steps to transcription by hand on a half sheet.

Monday:
Goal: Transcription, Translation, Replication Graphic Organizer. Describe, act-out, and explain the steps to translation.
1.) Go over translation steps in a list
2.) Go over translation in a video
3.) Go over translation by completing it by hand
4.) Write your own steps to translation by hand on a half sheet.

Tuesday:
Goal: Act out transcription and translation together.
1.) Go over steps to transcription and translation.
2.) Watch video of both together.
3.) Act out using the models.
4.) Act out using people.
5.) Quiz over Graphic Organizer

Wednesday
Computer Lab? Answering Curious Questions Awaiting Research.

Monday:
Goal: Distinguish between replication, transcription, and translation.
Show animations of transcription and translation.
Classification of DNA activities and descriptions.

Tuesday after Thanksgiving:
Nobel Prize DNA game.
Students complete transcription and translation activities on Utah website.

Wednesday:
Test Replication, Transcription, Translation.

Thursday and Friday
Goal: Describe the four different types of genetic disorders. Select one disorder summarize causes and symptoms.

Ending Mitosis, Cancer, going toward Replication Transcription and Translation

2008-11-02T16:41:00.001-08:00

Wednesday Nov. 5th
Goal: Label a diagram of chromosomes, describe phases of mitosis.
1.) Notes on DNA structure, use what is DNA Utah Ed Site, and Teacher's Domain Website. What is DNA and Genes?
2.) Reading and Notes Section 8.2
3.) Section 8.2 Quiz Tomorrow

Thursday Nov. 6th
Goal: Complete a Cell Cycle Role Play.
1.) Cell Cycle Roles Passed
2.) Complete Cell Cycle Roll Play outside multiple times with different roles.
3.) Cell Cycle Quiz
Assessment: Quiz

Friday Nov. 7th
Goal: Finish Mitosis Exploration Guide.
1.) Computer Lab Mitosis Investigation finish.
2.) Finish Evolution Timeline when done.
3.) DONE? Alien Reproduction Exploration.
Assessment: Exploration Guides

Monday Nov. 10th
Goal: Students complete research about a specific type of cancer.
1.) Students complete 6 slides over a type of cancer they are concerned about.
Assessment: Slides

Tuesday Nov. 11
Cancer Video with Sub?

Wednesday Nov. 12th
Goal: Students share their expertise with other students over the cancer they researched the day before. (maybe another day of research)
1.) Model how to have a conversation about their cancer projects.
2.) Students converse about cancer topics.
3.) Cancer Animation Online with Descriptions.
Assessment: Exit Sheet, Change of behavior, decreased cancer rates in students.

Thursday Nov. 12
Goal: Link animal protein consumption to possible immune deficiencies.
1.) Finish Cancer video
2.) Write summary half sheet.

Friday: Nov. 13th
Goal: Finish projects related to cancer. Possibly email a doctor and a chiropractor about the supposed cure for cancer.
1.) Finish powerpoints, print them off.
2.) Work on Jeopardy Questions related to given topics.

Monday
1.) Test Review: Cell Cycle, Cancer basics, Organism Organization (cell, tissue, organ, organ systems)
2.) Read Sections 8.2 and 8.3
3.) Start cutting for DNA projects

Tuesday
Goal: Students demonstrate understanding of cell cycle and its relationship to life. (Start cutting to make DNA strands)
1.) Test
2.) Start going over graphic organizer: Replication, Transcription, and Translation.
3.) Students complete a graphic organizer related to replication, transcription, and translation.
4.) Show animations of replication, transcription, and translation.
Exit Card: How are transcription and translation related?

Monday: Continue with replication, transcription, and translation.

From Evolution to Organism Growth, Mitosis

2008-10-23T10:41:00.000-07:00

Monday:
Goal: Students relate the process of evolution to the evolution dogs from wolves.
1.) Watch Dogs and More Dogs video.
2.) Answer questions related to Dog Evolution.

Tuesday:
Goal: Students synthesize information through an assessment
1.) Test
2.) Read Cell Cycle Section 8.2

Wednesday:
Goal: Students discuss the evolution of their favorite animal.
Goal: students will be able to describe the evolutionary history of their favorite animal.
1.) Quick pre-test review
Re-take online survey.
2.) Go over example of one powerpoint of evolutionary history of an animal. Students analyze internet information to create an evolutionary history of an animal.
3.) Print as handouts.

Thursday
1.) Model how to have a scientific conversation about your favorite animal.
2.) Students meet with other students and discuss their favorite animal projects.
3.) Question for homework: How do organisms grow?

Friday
Goal: Students create a timeline of scientific contributions to the theory of evolution.
1.) Computer lab timeline completion.

Monday:
Goal: Students model the process of mitosis using yarn and two ziploc bags.
1.) Quick mitosis review, discuss as a group how mitosis could be modeled using yarn and two ziploc bags.
2.) Students are given two ziploc bags and a set of 4, 5, or 6 chromosomes in pairs.
3.) Students complete mitosis repeatedly. Then summarize the steps in one paragraph.
4.) As a second paragraph, students write about how we could model mitosis using people to play roles.
Assessment: Exit paragraph.

Tuesday:
Goal: Students explore the process of mitosis through a computer lab investigation.
Students complete cell cycle and organism growth pre-unit survey.
1.) Students explore the process of DNA replication. Students record the steps, What does helicase do? Replicase? How much DNA do you start with? How much DNA do you end up with? What does this have to do with cell division? Students hand in a half sheet that explains replication using key terms.
2.) Explorelearning activity-Mitosis and Cell Cycle, until end of the period.
Assessment: 1/2 Sheet on Replication, Answers on exploration guide.

Wednesday
Goal: Students practice the steps to mitosis. They classify statements relating to the phases.
2.) Direct Instruction: What is mitosis? When does it happen? Big picture. Mitosis steps, book reading and notetaking.
3.) Students are given descriptions and place them in order on a cell cycle large sheet.
Assessment: Ordering of Cell Cycle on Big Sheet.

Thursday:
Goal: Complete the role play of mitosis
1.) Quick mitosis review.
2.) Pick two best descriptions from yesterday to lead the group into the modeling of mitosis.
3.) Mitosis quiz.

Friday: Tidy up computer lab activities. (Evolution timeline, Beginning Genetics Game)
Goal: Investigate problems with cell cycle.
1.) Students complete research on a specific type of cancer.

Continuing with Evolution

2008-10-17T18:44:00.000-07:00

Monday:
Goal: Students differentiate between artificial and natural selection. They describe that observations about artificial selection help lead Darwin to hypothesize natural selection.
1.) Quick Darwin, Natural Selection, and Scientific Theory Review.
2.) Artificial vs. Natural Selection quick notes and classification activity.
3.) Students read and take notes on section 15.2 specific sections.
4.) Set up Pasteur's experiment by boiling water with beans in two different test tubes.

Tuesday:
Goal: Students classify situations as being convergent evolution, founder effect, homologous structures, or adaptive radiation.
1.) Finish Notes on Section 15.2 and Evolution Evidence.
2.) creation of graphic organize with above key terms.
3.) Students go from desk to desk discussing situations as one of the four above.

Wednesday:
Goal: Students tie concepts related to evolution together.
1.) Students complete review sheet related directly to Indiana Evolution Standards.

Thursday:
Goal: Students determine the relationships between organisms based on similarities in their amino acid structures.
1.) Quick Review and Question answering session.
2.) Introduction of Amino Acids and Term "Polypeptide"
3.) Students complete Amino Acid Phylogeny Activity.

Friday:
Goal: Review evolution standards, Review Jeopardy
Assess students' understanding of evolutionary concepts.
1.) Unit Test: Evolution. (Maybe postponed to Monday because of lack of time)

Monday:
Test?

Computer Lab to do (No particular order):
Goal: Trace favorite organism's phylogeny using online resources, retake evolution survey, finish evolution powerpoint, make graphs over fly populations, mouse party interactive

Nov. 4th Sub:
Dogs and Many Dogs Video: Relating evolution and genetics to dogs.

Flex Day:
Goal: describe how scientists think life on earth started.
1.) Quick powerpoint review of main evolutionary and natural selection concepts.
2.) Quick Darwin, Natural Selection, and Scientific Theory Review.
3.) Reading section 14.1 and note taking.

History of Life on Earth and Natural Selection

2008-10-02T17:39:00.000-07:00

Monday:
Goal: Recognize and explore trends in the Fossil Record.
Engage "I would like to die next to a river and drown so that I could become a fossil" Agree or Disagree. Why?
1.) Fly populations observations.
2.) Fossilization Process Notes.
3.) Mock Fossil Record Activity-Notes, Conclusions.
4.) Read and Notes on section 14.1.

Tuesday:
Goal: Recognize and explore patterns of adaptation in a simulated activity.
Engage "Teacher pass their genes onto students by giving students knowledge?" Agree or Disagree. Why?
1.) Fly populations observations, review fossil record.
2.) Do all organisms live to the age of reproduction?
3.) Finding Toothpicks of different colors lab.-Analyze data .
4.) Relate activity to "Do all organisms live to the age of reproduction?" How do populations change over time?

Wednesday:
Goal: Explore Natural Selection through two computer simulations.
1.) Explorelearning.com Natural Selection activity.
2.) Nowhere to Hide interactive related to natural selection.
3.) Summarize the four main parts to Darwin's Theory of Natural Selection.

Thursday:
Goal: Students classify characteristics of the 4 primary macromolecules that make up life.
1.) Review of 4 macromolecules going around the room.
2.) Compare to other students

Friday:
Goal: Describe how seed dispersal relates to Natural Selection.
1.) "Plants do not evolve because they don't have any variation." Agree or Disagree? Why?
2.) Students take turns using their seed dispersal techniques to try and get a seed to travel as far as possible. (each student tries twice and finds the average)

Monday
How we learn ppt:
Goal: Students realize the brain grows dendrites when they learn something new.
1.) Brain ppt. with interactive sections.

Tuesday
Goal: Describe four attributes of a scientific theory.
1.) "A theory is more valid than a hypothesis because it is based on evidence"
-Finish going over macromolecule graphic organizer
-Make Fly observations
2.) Attributes of a theory details.
-Based on evidence
-Explains situations
-Falsifiable
-Makes predictions
3.) Reading and notes on Darwin's theory. (pg. 393-396)
4.) Natural Selection and History of Life on Earth Quiz on Wednesday

Wednesday:
Goal: Students describe four types of evidence for evolution
1.) Review theory attributes
2.) Reading and notes on pg. 396-403
3.) Exit half sheet, "What is the most convincing piece of evidence for you? Why?"

Thursday
Goal: describe the different mechanisms of evolution.
-Review the 4 parts of Natural Selection, 4 attributes of a scientific theory.
1.) Read and notes pg. 407-413.
2.) Complete Graphic Organizer related to mechanisms of evolution.

Friday
Goal: apply the concept of evolution and natural selection in the creation of a seed dispersal device.
1.) Testing Seed Dispersal Devices.
2.) Relating to Natural Selection discussion.
3.) Use notes to determine which type of evolution happened between the last generation of seed dispersal devices and the current devices.

Monday:
Goal: Summarize evidence for evolution using a powerpoint presentation
1.) Review Natural Selection, Theory, Evidence for Evolution.
2.) Students complete 6 slides, 3 supporting, 3 anti-evolution

Tuesday:
Goal: Complete Lab Report over population dynamics.
1.) Final Observations of Fly Lab.
2.) Make Graphs and write results and conclusion to Fly Lab.

Wednesday
Review Questions based on Standards

Thursday:
Goal: Students construct a phylogenetic tree based on amino acid sequences of a globin protein.
1.) Review of protein structure.
2.) Introduce protein activity.
3.) Students complete activity.

Friday:
Test over Evolution and previous standards addressed in class.

Monday:
Goal: Students construct a phylogenetic tree based on nucleotide sequences of a DNA molecule.
1.) Review of DNA structure.
2.) Introduce DNA activity.
3.) Students complete activity.

Tuesday:
Goal: Students start research into favorite animal and their phylogenetic tree (based on material evidence).
1.) Pick a favorite animal.
2.) Create a phylogenetic tree based on amino acid sequences using the website in Mr. Gensic's Links.
3.) Record the phylogenetic tree.

Sept. 29 and Oct. 6

2008-09-28T17:56:00.000-07:00

Monday
Pond Ecosystem Gizmo and Graph Creation

Tuesday
Read and Notes on Section 4.2 and 5.1

Wednesday
Review Sheet and Standards on Test

Thursday
Evidence for Evolution Webquest and Survey Completion

Friday
Test-Ecology yet Cumulative

Monday
Theory Characteristics (Evidence Based, Falsifiable, Make Predictions, Explains Observations) NOT A HUNCH OR SPECULATION
Darwin Notes
Darwin vs. Lamarck Classification

Tuesday
Natural Selection Reading

Wednesday
Evolution Gizmo

Thursday
Finish Germination and Fly Population Labs (with graphs and evidence based claims)

Friday
Continue with Evolution by means of Natural Selection activities (Colored Toothpicks?)

Week on 9/22

2008-09-20T17:35:00.000-07:00

The next test will be coming up next week. It will be over activities done in class, Sections 2.2, 3.1, 4.1, 4.2, and 5.1 in the book, and also the ecology key questions sheet.

Monday
Goal: Create a Pledge Sheet for commitments towards preserving the Great Lakes.
1.) Rotate between different groups writing down what we should do to help save the lakes. Share your findings with other groups in small group discussion.
2.) Try to come up with one big project our class can do (not involving a field trip)
3.) Cycles Quiz Tuesday, Review Cycles Quiz
4.) Start Fruit Fly Population and Seed Germination Experiment.

Tuesday
Goal: Describe the relationship between photosynthesis and respiration to better understand the carbon cycle.
-Go over survey results.
1.) Describe chemical reaction after viewing Sodium and chloride reaction to form salt. Show cell energy cycle gizmo.
2.) Notes on Photosynthesis and Respiration in a T-Chart. (location, reactants, products, purpose)
3.) Observations of Fruit Fly populations and seed germination experiment.
4.) Cycles quiz
5.) Homework: Read and take notes on Section 3.1 (Reviews field trip information)

Wednesday:
Goal: Describe the relationship between photosynthesis and respiration to better understand the carbon cycle.
1.) Complete Problem Solving Lab pg. 72 in class.
2.) Make observations for fruit flies and seed germination.
3.) Students take notes on Section 4.1

Thursday:
Goal: Students relate ecological concepts to human population dynamics.
1.) Students complete problem solving lab on pg. 101.
2.) Make observations for fruit flies and seed germination.
3.) Students take notes on Section 4.2.

Friday:
1.) Plant and Animal Independence Gizmo
2.) Complete survey.
2.) Students work on ecological key concepts sheet when done.

Next week-Review Monday, Test Tuesday? Start Mitosis Wednesday?

Dune Field Trip Pics

2008-09-16T14:34:00.000-07:00

Week of 9/15

2008-09-13T08:39:00.001-07:00

Monday 9/15:
1.) Succession PPT
2.) Ecology Connections big sheet with explanations. Circle the autotrophs. Put a Squiggle around the heterotrophs. Show the flow of energy in the system.

Tuesday (Just First and Second Hour)
1.) Field Trip Expectations
2.) Cycles Survey
3.) Dunes Online Questions
4.) Go over cycles survey

Wednesday
1.) Review Field Trip (Introduce the field trip, The first time I saw..., Things that related to class, I think the most pressing issue to Great Lakes is_________ because), What I liked best about the hike was...) Brainstorm first.
2.) Show pictures from the field trip as a review of the hike.
3.) Turn brainstorming into five paragraphs.

Thursday: Describe Cycles in nature
1.) Read and take notes on carbon cycle section 2.2

Friday: Computer Lab work day
1.) Create ppt. presentation related to your topic.
a.) Introduce your topic
b.) Explain how it impacts the ecosystem.
c.) Explain why it is more pressing than other issues.
d.) Offer possibilities for fighting/preventing these issues from
d.) Try to persuade others to join in action to help fight this issue.

Great Lakes Grid

2008-09-10T18:25:00.000-07:00

Use the following link to access the Great Lakes Ecosystem website analysis grid. Be sure to use your own words and complete sentences to summarize the websites.